Hereditary Neuroblastoma and Congenital Central Hypoventilation Syndrome (ALK, PHOX2B)

Germline predisposition to neuroblastic tumours (neuroblastoma, ganglioneuroblastoma and ganglioneuroma) caused by activating ALK variants and by PHOX2B variants, congenital central hypoventilation syndrome and its forms with Hirschsprung disease, and neuroblastoma in predisposition syndromes (RASopathies, CDKN1C-related Beckwith-Wiedemann syndrome, Weaver syndrome, 2p24.3 duplication involving MYCN, ROHHAD).

Literature and regulatory information updated: 17 October 2026.

0. Reference Summary Table

Neuroblastoma (NB) is an embryonal tumour of the sympathetic nervous system that, together with ganglioneuroblastoma (GNB) and ganglioneuroma (GN), makes up the spectrum of neuroblastic tumours [1, 2]. Congenital central hypoventilation syndrome (CCHS) shares the PHOX2B gene with familial NB and is covered in full in this article; isolated Hirschsprung disease (HSCR), the Beckwith-Wiedemann spectrum (BWS), Li-Fraumeni syndrome (LFS), the RASopathies, neurofibromatosis type 1 (NF1) and Wilms tumour predisposition are addressed only insofar as they concern NB. The following table gives the identification of each entity; the second table summarises the clinical and management data, including the relevant European Reference Network (ERN).

1. Introduction

1.1. From families with neuroblastoma to the two-hit model

Familial aggregation of NB was recognised long before the genes were identified. Dodge and Benner described in 1945 a brother and sister with NB of the adrenal medulla, and the following decades accumulated reports of affected sibships, of parents with mediastinal ganglioneuromas and of asymptomatic parents with persistent catecholamine excretion; in one of these families, the mother of four siblings with NB had a posterior mediastinal mass that, on retrospective review of the radiographs, had remained stable for at least 16 years [14]. In 1972, Knudson and Strong analysed these families and proposed autosomal dominant inheritance with a penetrance of about 63% and a two-hit mechanism analogous to that of retinoblastoma, in which the first hit is inherited and the second is somatic; they also concluded that the age at onset of familial cases, earlier than that of sporadic cases, was consistent with this model and that recessive inheritance was unlikely [14–16]. The observation of microscopic foci of NB in situ in the adrenal glands of about 1 in 200 infants, described by Beckwith and Perrin in 1963, suggested early on that many initiated tumours never become clinically manifest, which anticipates the incomplete penetrance and spontaneous regression discussed below [14].

1.2. PHOX2B, central hypoventilation and the neurocristopathies

Congenital central hypoventilation was described by Mellins and colleagues in 1970, in an infant with failure of the automatic control of ventilation [17, 18]. The expression “Ondine’s curse” had been coined by Severinghaus and Mitchell in 1962 for adults with prolonged apnoeas during wakefulness who breathed on command, and was later applied to CCHS [18]. In 1978, Haddad and colleagues described three female infants, two of them sisters, with the combination of sleep hypoventilation and Hirschsprung disease, with oesophageal dysmotility and reduced heart rate variability; all died in the first months of life and autopsy showed no anatomical defect [18]. The association of CCHS with NB and ganglioneuroma, also described in 1978 and 1989, led to CCHS being classified among the neurocristopathies, disorders caused by defective migration or differentiation of neural crest cells [18]. In 2003, Amiel and colleagues identified heterozygous de novo PHOX2B variants in 18 of 29 patients with CCHS, mostly expansions of 5 to 9 alanines in a 20-residue tract, and Weese-Mayer and colleagues found the exon 3 expansion in 65 of 67 probands (97%), with a relationship between expansion length and severity [18–20]. In 2004, Trochet and colleagues and Mossé and colleagues demonstrated germline PHOX2B variants in families with NB and in a patient with the HSCR–NB association, making PHOX2B the first gene with germline variants predisposing to NB [4, 21, 22].

1.3. ALK as the main gene of familial neuroblastoma

In 2008, four papers published in the same issue of Nature identified ALK as a NB oncogene. Mossé and colleagues found a linkage signal at 2p23–24 in families with NB and three germline missense variants in the ALK tyrosine kinase domain segregating with the disease in eight families, with incomplete penetrance, as well as somatic variants in the same domain in 12.4% of 194 high-risk NB [23, 24]. Janoueix-Lerosey and colleagues, in France, described recurrent ALK copy-number gain, somatic variants clustered in two hotspots and germline variants in two families [25]. Chen and colleagues, in Japan, found missense variants in 13 of 215 tumours (6.1%) and in 8 of 24 cell lines (33%), and George and colleagues, in the United States, in 8% of primary NB, with F1174L as the most frequent somatic variant and sensitivity of transformed cells to an ALK inhibitor [26, 27]. The authors concluded that inherited ALK variants are the main cause of familial NB [23]. In 2012, a French series of patients with perinatal, multifocal NB or with multiple neoplasms showed that germline ALK variants are rare even in patients with a high probability of predisposition and that some are shared by unaffected relatives, describing the syndrome as “rare and of weak penetrance” [28].

1.4. Surveillance recommendations and broadening of the spectrum

In 2016, the Childhood Cancer Predisposition Workshop of the American Association for Cancer Research (AACR) set a childhood cancer risk threshold of 5% for recommending screening and published in 2017 a surveillance protocol for hereditary NB [16, 29]. The 2023 update, published in 2024, lowered the inclusion criterion to an NB prevalence of at least 1% in carriers or segregation in at least two families, added Weaver syndrome, the 2p24 duplication and ROHHAD, removed the TP53 p.R337H variant and reduced the frequency of chest radiography [2]. In 2017 and 2018, recessive forms of CCHS due to MYO1H and LBX1 were described, each in one consanguineous family, and between 2019 and 2023 the megalencephaly-polydactyly syndrome due to MYCN gain-of-function variants with NB in infancy was defined [30–32]. In 2026, analysis of 113,431 genomes attributed to 2p24.3 microduplications including MYCN a penetrance of about 13% for embryonal tumours [12].

1.5. Nomenclature and definitions

The designation “Ondine’s curse” is a literary misnomer: in the Germanic epic it was not Ondine who cursed the mortal, and patients do not “forget” to breathe nor are they “cursed”; GeneReviews discourages the term [8]. The abbreviation LO-CCHS (later-onset CCHS) designates the form presenting after the first month of life; the adjective “congenital” seems inappropriate when the diagnosis is made in adulthood, but review of these patients’ histories reveals early mild manifestations that had not been recognised [7, 8]. For the purposes of this article, ALK-related neuroblastic tumour susceptibility (ALK-NTS) is the presence of an activating heterozygous germline variant, pathogenic or likely pathogenic, in the ALK tyrosine kinase domain, with an increased risk of NB, GNB and GN [3]. PHOX2B-related susceptibility is the presence of a germline PHOX2B variant, with or without CCHS or HSCR, associated with neuroblastic tumours [4]. CCHS is alveolar hypoventilation due to deficient central autonomic control of breathing, with global autonomic dysfunction, without primary neuromuscular, pulmonary or cardiac disease or a brainstem lesion to explain it; the 2020 European guideline retains this definition and adds that confirmation requires, in most cases, a PHOX2B variant [7, 8]. Haddad syndrome is the coexistence of CCHS and HSCR [33]; Hirschsprung disease-ganglioneuroblastoma syndrome (ORPHA:2151) is total or partial colonic aganglionosis associated with peripheral neuroblastic tumours, usually multifocal, with CCHS of variable severity in some patients [34]. ROHHAD is a clinical syndrome, with no identified gene, that overlaps with CCHS in hypoventilation and dysautonomia, but begins after a period of normal development and is preceded by rapid weight gain [8, 13]. The OMIM nomenclature NBLST1 to NBLST7 mixes Mendelian genes (KIF1B, PHOX2B, ALK) and common association loci (6p22, 2q35, 1q21.1, 11p15) that do not confer Mendelian risk [14, 35–38].

2. Molecular Genetics and Pathophysiology

2.1. Origin of neuroblastic tumours and architecture of predisposition

Neuroblastic tumours derive from embryonic cells of the primitive neural crest that give rise to the adrenal medulla and the ganglia of the sympathetic nervous system; histologically they range from NB, formed by immature neural precursors, to GN, formed by mature neural tissue, with GNB in an intermediate position whose behaviour depends on the histology [3, 14]. Germline predisposition accounts for a small fraction of NB: about 1–2% of patients have a family history of NB, and a further 3–4% have bilateral or multifocal disease without a family history, often at a younger age, which also suggests predisposition [2]. The proportion of families explained by known genes varies between sources: GeneReviews attributes about 75% of familial cases to ALK gain-of-function variants, AACR 2024 states that ALK explains at least 50% of hereditary NB, AACR 2017 estimates that in about 15% of families the gene is unknown, and Taylor and colleagues report identification of the responsible gene in about 85% of familial NB [2, 3, 12, 16, 39]. Beyond the Mendelian genes, genome-wide association studies (GWAS) have identified common alleles of modest risk at 6p22, BARD1, 1q21.1 and LMO1, which act as a polygenic background and do not justify surveillance [2, 35–38].

2.2. ALK: structure, function and mechanism

ALK encodes a single-chain receptor tyrosine kinase of the insulin receptor superfamily, with transient expression in the developing central and peripheral nervous system and a postulated role in neuronal differentiation [3, 40]. The ligand ALKAL2 activates the MAPK (ERK1/2), PI3K/AKT and NF-κB pathways [40]. In NB, germline and somatic variants are located exclusively in the tyrosine kinase domain and cause constitutive, ligand-independent phosphorylation and activation of the receptor; in sympathetic precursors this signal diverts cells towards proliferation [3, 40]. Proof of direct oncogenicity came from experimental models: the mutated forms autophosphorylate and activate downstream targets, transform NIH3T3 fibroblasts and Ba/F3 cells, form tumours in nude mice, and ALK inhibition by RNA interference induces apoptosis and reduces proliferation of cell lines with mutated or amplified ALK [3, 24, 26, 27]. The mechanism is therefore gain of function; no pathogenic intragenic deletions or duplications have been described, and ALK copy-number analysis has no diagnostic indication in the germline [3].

2.3. Spectrum of ALK variants and nomenclature

Germline variants are single-nucleotide substitutions in key regions of the kinase domain; p.(Arg1275Gln), historically R1275Q, is the most frequent, both in the germline and in the tumour, and accounts for about 45% of the germline variants described [3, 16]. The following table brings together the variants reported in GeneReviews and in AACR 2017, with Human Genome Variation Society (HGVS) nomenclature confirmed in VariantValidator on the MANE (Matched Annotation from NCBI and EMBL-EBI) reference transcript NM_004304.5 and the germline classification in ClinVar at the date of consultation; the crizotinib sensitivity indicated derives from preclinical studies [3, 41, 42].

The classifications of I1183T and L1204F illustrate a practical limitation: AACR 2017 included them among the predisposing variants, but ClinVar now classifies them as of uncertain significance in the germline, and the somatic oncogenic classification may differ from the germline one [16, 42]. ClinVar holds thousands of pathogenic ALK entries, dominated by somatic submissions, which cannot be used to estimate the frequency of germline alleles [40]. The GeneReviews variants were supplied by the chapter authors and GeneReviews did not independently re-evaluate their classification [3].

2.4. Somatic ALK alterations and implications for the germline

Activating somatic ALK variants occur in 8–10% of NB, according to GeneReviews and AACR 2017, with ALK aberrations in about 14% of high-risk tumours; Table 1 of the same GeneReviews gives 7–8% and the ESMO handbook 6–17%, differences that reflect the series and methods of each study [3, 16, 43–45]. Tumours with an activating somatic variant have a worse prognosis than tumours of similar stage and biology, and p.(Phe1174Leu) associated with MYCN amplification confers a worse prognosis than amplification alone [3]. Somatic ALK amplification (more than 10 copies at 2p23) occurs in a subgroup of sporadic NB with unfavourable biology [3]. Rarely, a variant found in the tumour is germline: in 167 tumours from isolated high-risk cases, 14 had predicted activating ALK missense variants; germline DNA was available for 9 and in only 1 was the variant also in the germline [3, 23]. In 2026, a SIOPEN (International Society of Paediatric Oncology Europe Neuroblastoma) harmonisation study proposed common rules for reporting ALK alterations in NB [46]. ALK translocations generating fusion proteins, characteristic of anaplastic large cell lymphoma, non-small cell lung cancer (NSCLC) and inflammatory myofibroblastic tumour, are somatic and are not part of NB predisposition [3].

2.5. Penetrance, genotype-phenotype correlations and allelic ALK phenotypes

The overall penetrance of germline ALK variants is about 50%, an estimate based on a small number of families [2, 3, 16]. In a 2008 commentary on the family studies, the weighted mean penetrance was about 57%, with one variant at about 40% and the others at 61% on average [24]. p.(Arg1275Gln) appears to have somewhat reduced penetrance (about 40%), and in a family with p.(Gly1128Ala) 40% of heterozygotes had NB in childhood, with no other tumours; in one family, a child with NB inherited p.(Arg1275Gln) from an unaffected parent [3]. There are no other established correlations between germline variant and risk or prognosis [3]. The explanations proposed for incomplete penetrance are the absence of a second hit and spontaneous regression of initiated tumours [16]. In a study of 32 patients with multifocal or hereditary NB, only 3 (about 10%) had activating ALK variants, and the 2012 French series found p.(Thr1151Arg) and p.(Arg1192Pro) inherited and shared by unaffected relatives, as well as a de novo p.(Arg1275Gln) in a patient with perinatal onset; all carriers had multifocal tumours, and young age did not prove a useful criterion for selecting testing [2, 24, 28]. Two de novo germline variants, p.(Phe1174Val) and p.(Phe1245Val), were found in two unrelated children with congenital NB, severe encephalopathy and abnormal brainstem morphology; these variants, frequent as somatic variants, have never been described in the germline of individuals with a normal phenotype, and the authors proposed that the absence of the most activating variants from the germline reflects severe effects on embryonic development [3, 47]. The case in section 10, with de novo p.(Phe1174Ile), multifocal NB and central hypoventilation without a PHOX2B variant, broadens this allelic phenotype [48]. A total of 12 patients with glioma carrying germline ALK variants have been described, but only one in the kinase domain (nonsense), none recurrent and without study of the second allele; rare germline variants have been described in medulloblastoma; GeneReviews concludes that there is insufficient evidence of an increased risk of central nervous system tumours [3].

2.6. PHOX2B: structure, function and mechanism

PHOX2B (4p13) encodes a highly conserved paired-like homeodomain transcription factor of 314 amino acids that directs the development of the autonomic nervous system, including noradrenergic populations such as the locus coeruleus, and specifies the neurotransmitter phenotype [8, 49]. The protein has two short, stable polyalanine repeats, of 9 and of 20 residues, encoded in exon 3 by GCN triplets (GCA, GCT, GCC or GCG, all encoding alanine) [8]. In the human embryo, PHOX2B is expressed in the central and peripheral autonomic nervous system, which explains the association between hypoventilation, autonomic dysfunction, HSCR and neuroblastic tumours [19]. All pathogenic variants alter the protein downstream of the homeodomain; as PHOX2B binds DNA as a dimer, the abnormal protein can interfere with the normal one, and several lines of evidence support a dominant-negative mechanism for the expansions, with misfolding and aggregation [8, 49]. Non-expansion variants and deletions of the gene or of exon 3 act mainly through loss of function, and ClinGen assigns PHOX2B a haploinsufficiency score of 3; the relationship between haploinsufficiency and phenotype is not yet clear [8, 49]. The central physiological deficit is absent or attenuated central chemoreception of CO2 [49].

2.7. Classes of PHOX2B variants and notation

There are three classes of variants: expansions of the second polyalanine region of exon 3 (PARM, polyalanine repeat expansion mutations), non-expansion variants (NPARM: missense, nonsense, splicing, stop-codon and frameshift variants, the latter more frequent within the repeat) and whole-gene or exon 3 deletions, which constitute a subgroup of NPARM not detected by sequencing [8]. The PARM genotype is written as 20/N, where N is the number of alanines in the expanded allele [8]. The most common normal allele has 20 repeats; contractions without a CCHS phenotype have been described, with 13, 14 and 15 repeats and a shorter contraction that GeneReviews records as 7 repeats in one section and 9 in another [8]. The 2020 European guideline adds that contractions of the polyalanine tract and large deletions of the whole locus have been associated, in rare cases, with phenotypes compatible with CCHS, isolated HSCR, brief resolved unexplained events (BRUE) and dysautonomia [7]. GeneReviews classifies the lengths as follows: 21 to 23 repeats are of uncertain significance and have never been described with CCHS; 24 repeats and a subgroup of 25-repeat alleles are associated with a very mild phenotype, of late onset or revealed only by respiratory depressants or severe intercurrent lung disease; 26 to 33 repeats and most 25-repeat alleles are associated with neonatal onset; the largest known expansion has 33 repeats [8]. The same document classifies the 20/24 genotype in the text as fully penetrant with late onset and, in the note to its Table 2, as a susceptibility allele that requires another factor to become manifest or of low and variable penetrance, with manifestations that can be triggered by drugs or the environment [8].

The HGVS notation of the expansions uses duplications of the alanine tract, because the GCN repeat is heterogeneous and the codon-number notation (c.721_723[24_33], used in GeneReviews on NM_003924.3) was not accepted by VariantValidator; the following table uses the MANE transcript NM_003924.4 and the ClinVar entries [8, 41, 42].

The conversions of the NPARM variants started from the classical c. notations in the literature and were validated in VariantValidator; the resulting protein matches the historical nomenclature [41]. ClinVar also uses repeat notation for some entries, for example c.741CGCGGCAGCGGCGGCGGCGGC[3] [42].

2.8. Repeat stability, mosaicism and inheritance of PHOX2B

The PHOX2B repeat has no described interruptions, shows no somatic instability and is transmitted stably from parent to child, even from mosaic parents, unlike the trinucleotide expansion disorders with anticipation [8]. Most cases of CCHS result from a de novo variant; somatic or germline mosaicism is present in about 5–25% of asymptomatic parents, and a Japanese study of 45 families found 1 patient (2%) who inherited a 5-alanine expansion from a parent with LO-CCHS and 9 (20%) who inherited 5- to 7-alanine expansions from apparently asymptomatic parents with somatic mosaicism of 5 to 62% [8, 18, 50]. Pure germline mosaicism, with no detectable somatic component, has also been described in a very limited number of parents [8, 51]. Inheritance is typically AD; in two families the disease resulted from biallelic variants of reduced penetrance: a homozygous 24/24 proband and an infant with 20/24 in trans with p.(Gly262Val), each inherited from an asymptomatic parent, with neither variant alone causing disease in several carrier relatives [18, 52, 53].

2.9. PHOX2B genotype-phenotype correlations and tumour risk

Expansion length is related to the severity of autonomic dysfunction, to the need for continuous ventilation (an inconsistent relationship), to the risk of sinus pauses and to that of HSCR [7, 8]. In a Japanese series of 92 patients, the 19 with 20/25 had a male/female ratio of about 3:1, none had HSCR and 7 presented after the neonatal period, whereas the 73 with 26 or more repeats or NPARM all had neonatal hypoventilation, with frequent HSCR and constipation [6, 18]. NPARM have a broad spectrum, from mild hypoventilation to extensive intestinal involvement, continuous ventilation and increased tumour risk after the first year, with differences within and between the missense, nonsense and frameshift classes; the severity of frameshifts depends on whether the reading frame is shifted by one or two positions [7]. The risk of neural crest tumours depends on the variant class. Analysis of 188 French probands, with a detection rate of 92.6%, showed that patients with CCHS and a malignant tumour of the sympathetic system mainly have missense or frameshift variants [18, 54]. AACR 2017 estimated the risk at about 45% in NPARM and about 1–2% in PARM, almost exclusively in expansions of 30 to 33 repeats; GeneReviews gives less than 5% in genotypes 20/30 to 20/33 and 50% in NPARM; AACR 2024 gives about 5% neuroblastic tumours in CCHS overall and states that, in patients with NB and CCHS, the PARM are typically of 28 or more repeats; the 2020 European guideline gives 3–5% tumours in CCHS; the OMIM entry for NBLST2, based on series from 2002 and 2003, gives 5–10% [2, 4, 7, 8, 16, 54, 55]. The attribution of the 50% to the recurrent 38 bp deletion, which appears in an automated reading of Table 2 of GeneReviews, does not match the GeneReviews text, which attributes the 50% to NPARM in general [8]. Outside CCHS, germline PHOX2B variants occur in families with NB, GNB and GN without HSCR or autonomic dysfunction, with incomplete penetrance [4, 16].

2.10. Other central hypoventilation genes

The mutations described in RET, BDNF, GDNF, ASCL1 and EDN3 as causes of CCHS or Haddad syndrome have all been reclassified as variants of uncertain significance, and the patients with GDNF and RET variants described in 1998 in fact had the PHOX2B expansion [18]. On the other hand, the RET haplotypes predisposing to non-syndromic HSCR modulate the risk of HSCR in patients with PHOX2B variants (odds ratios of 2.39 in heterozygosity and 4.74 in homozygosity for the ATA haplotype in a series of 143 patients), which makes RET a modifier [18]. The CCHS2 form results from homozygous MYO1H variants, described in three siblings of consanguineous parents with neonatal hypoventilation, absent response to CO2, gastrointestinal dysmotility and bladder dysfunction, and CCHS3 from a homozygous frameshift LBX1 variant in two siblings of consanguineous parents, PHOX2B negative, with hypoventilation, hypertensive crises with pallor and sweating, and heat intolerance [7, 30, 31]. The European guideline considers CCHS a genetically heterogeneous trait and mentions patients with the phenotype without an identified variant [7].

2.11. MYCN: 2p24.3 duplication and point gain of function

Germline 2p24 duplication increases the frequency of NB and Wilms tumour; the duplicated region varies, but always includes MYCN and DDX1, about 340 kb apart, and not always ALK, which lies about 14 Mb more distally at 2p23.1 [2, 3]. In 2026, genome sequencing of 113,431 Genomics England participants identified 6 carriers of a 2p24.3 microduplication involving MYCN, of whom 2 had Wilms tumour and 1 NB; the microduplication was present in 3 of 197 participants with a history of Wilms tumour or NB and in 3 of 113,234 without such a history (p < 0.0001), with a penetrance estimated at 13% by Bayesian calculation; none of the 12 carriers of duplications including DDX1 but not MYCN had an embryonal tumour [12]. The authors attribute the risk to MYCN and not to DDX1, which refines the AACR 2024 wording [2, 12]. MYCN point gain-of-function variants, p.(Thr58Met) and p.(Pro60Leu) in OMIM protein notation, occurred de novo in patients with megalencephaly, ventriculomegaly, postaxial polydactyly and NB in infancy (at 7 and at 3 months); they reduce phosphorylation at Thr58 and stabilise the protein, and the phenotype is the mirror image of Feingold syndrome type 1, caused by MYCN loss of function [32, 56]. The NBAS gene, co-amplified with MYCN in NB cell lines, is not a predisposition gene: NBAS disease is a syndrome of recurrent acute liver failure and short stature [57].

2.12. Syndromic genes with recommended surveillance

In BWS, inactivating CDKN1C variants are associated with NB as the most frequent cancer, more so than the epigenetic causes at 11p15, with an overall prevalence of 3–4% according to AACR 2024 and of 4.2% in the 2018 international consensus [2, 10]. In Costello syndrome, activating HRAS variants confer a cancer risk of 15–20% by age 20 years, mainly rhabdomyosarcoma, NB and bladder carcinoma, with an NB risk of 1–2% or 2%; neoplasms have been described only with variants predicting p.Gly12 substitutions [2, 11]. In Weaver syndrome, caused by EZH2 variants (classified as inactivating in Table 1 of AACR 2024), NB is the most frequent cancer: in a synthesis of published cases, 8 of 56 patients had cancer and 6 of them NB, giving about 11% with probable publication bias [2, 58].

2.13. Genes without recommended surveillance and emerging genes

AACR 2024 lists genes with emerging evidence that do not reach the surveillance threshold [2]. SMARCA4, already associated with rhabdoid tumours, uterine sarcomas and small cell carcinoma of the ovary, hypercalcaemic type, was found in germline heterozygosity in 11 patients with NB, with a median age at diagnosis of 5 years (2 months to 26 years), 9 male, 8 of 9 tumours in the adrenal gland, 8 loss-of-function and 4 missense variants, and loss of heterozygosity of the wild-type allele in the 8 tumours tested [2, 59]. BARD1 was associated with high-risk NB by GWAS, and in germline sequencing of 786 patients 13.9% had pathogenic or likely pathogenic variants in cancer predisposition genes in general (odds ratio 1.60; 95% confidence interval, 95% CI, 1.27–2.00), with BARD1 as the most enriched gene (odds ratio 32.30; 95% CI 6.44–310.35; 8 of 786 patients, 1%), copy-number variants disrupting BARD1 absent in controls and worse overall survival in carriers (p = 8.6 × 10⁻³) [2, 36, 60]. BARD1 variants cause haploinsufficiency and a DNA repair defect, but no families with segregation have been described [2]. For KIF1B (1p36.2), whose product KIF1Bβ mediates apoptosis of sympathetic neurons deprived of nerve growth factor downstream of EglN3, germline loss-of-function missense variants have been described in 3 patients with NB and in one with phaeochromocytoma, and a family with p.(Ser1481Asn) in which the phaeochromocytoma was later attributed to a MAX variant; these are only 4 individuals [2, 14, 61, 62]. GALNT14 p.(R268C), in the article’s notation, co-segregated with NB in a family that already carried the ALK variant p.(Gly1128Ala), less than 1 Mb away, which may explain the segregation [2]. In LFS, NB is not a classical tumour; cases have been described in carriers of the TP53 variant NM_000546.6:c.1010G>A p.(Arg337His), the “Brazilian variant”, but the prevalence of NB was estimated at below 1%, and AACR 2024 no longer recommends specific surveillance, unlike 2017 [2, 16, 41, 63]. In Noonan syndrome, NB is among the neoplasms described, but below 1%; in NF1 the estimated prevalence is 0.2%, and homozygous NF1 inactivation in primary NB does not alter this conclusion [2, 11, 16]. Other genes have emerged from sequencing of children with cancer or from GWAS without proof of familial segregation: SDHB, SDHA, APC, BRCA1, BRCA2, CHEK2 c.1100delC and non-coding variants of CFDP1, CDKN1B, LIN28A, LIN28B, METTL3 and METTL14; one LMO1 variant is associated with decreased risk, and the protective T allele of the rs2168101 polymorphism in the LMO1 super-enhancer eliminates a GATA3 binding site (odds ratio 0.65; 95% CI 0.60–0.70); the 16p11.2 deletion is associated with NB with a risk below 1% [2, 38, 64]. CLOVES syndrome, part of the mosaic PIK3CA-related overgrowth spectrum, has a single report of high-risk NB [2].

2.14. Gene-disease validity and actionability

ClinGen classifies as definitive the association of ALK with neuroblastoma susceptibility type 3 and that of PHOX2B with CCHS1 with or without HSCR and with Haddad syndrome; there is no ClinGen curation of PHOX2B for isolated NB [65]. Definitive validity is not to be confused with actionability: according to the GeneGuidance record, the ClinGen paediatric actionability curation assigns limited actionability to ALK-related NB susceptibility, which reflects the scarcity of evidence on the effect of surveillance on outcome and does not contraindicate the surveillance protocol [40]. For KIF1B, the GenCC curations classify the association with NB as limited [62].

3. Clinical Spectrum and Manifestations by System

3.1. Neuroblastic tumours in germline predisposition

NB is the most frequent extracranial solid tumour of childhood, accounts for 8% of paediatric cancers and 15% of paediatric cancer deaths, and is the most frequent cancer diagnosed before 1 year of age [2, 14]. Its presentation depends on stage and location along the sympathetic system, from a localised mass to metastatic disease in bone, bone marrow, liver, lymph nodes, lung, central nervous system and skin [1]. About 80% of NB arise in the adrenal medulla or the paravertebral sympathetic chain below the diaphragm and about 20% in the neck and thorax, the latter more often mature or slow-growing [2]. About 90% secrete catecholamines intermittently, mainly dopamine and noradrenaline [2]. Orphanet records as frequent (30–79%) NB itself and nervous system neoplasms, and as occasional (5–29%) raised urinary and circulating catecholamines, weight loss, thrombocytopenia, anaemia, fever, chronic diarrhoea, lymphadenopathy and abdominal distension [1, 66].

In germline predisposition, tumours arise earlier and are more often multiple: the mean age at diagnosis in familial NB was about 9 months, compared with 2–3 years without predisposition, and there is a higher incidence of multiple primary tumours, such as bilateral adrenal tumours or extra-adrenal primaries in the sympathetic ganglia, synchronous or metachronous [3]. This observation is not uniform: AACR 2017 states that carriers of germline ALK variants do not appear to develop NB earlier than the general population, and AACR 2024 that age at diagnosis does not appear to differ between predisposition syndromes, with limited data [2, 16]. In the general population, the median age at clinical diagnosis is about 20 months in a series of 3666 cases from the Children's Oncology Group (COG), with 80% of diagnoses by age 6 years and 98% by age 10 years, values that underpin the age at which surveillance ends [2, 16]. In families, benign and malignant tumours coexist: germline ALK variants are equally likely in the three histological types and at any NB stage, so histology and stage do not identify the carrier [3]. There are reports of late-diagnosed GN and GNB in adult relatives, such as the adrenal GN removed at age 44 years in the father of a family with PHOX2B p.(Arg100Leu), and the adult-onset GNB in the father and paternal grandmother of a child who died at age 5 years with metastatic NB, in a family with p.(Gly197Asp) [4].

3.2. Carriers of ALK variants

Most germline ALK carriers have no phenotype other than the predisposition [3]. About 45–50% develop a neuroblastic tumour over their lifetime, with the highest risk in infancy, decreasing until the end of childhood [3, 29]. No tumours other than neuroblastic tumours are reliably associated with the germline variant, and there are no cancer risk data for heterozygous adult parents [3]. The severe allelic phenotype with encephalopathy, brainstem abnormalities and, in the case in section 10, central hypoventilation results from highly activating de novo variants [47, 48]. There are no statistically significant long-term outcome data; long-term heterozygous survivors have been described, no prospective study has compared survival with and without a germline variant, and survival appears to depend more on tumour type, stage and treatment than on the variant [3].

3.3. CCHS: respiratory manifestations

CCHS represents the extreme manifestation of autonomic nervous system dysregulation (ANSD), with altered respiratory control as its hallmark [8]. In the classical form, ventilation is adequate during wakefulness and there is apparent hypoventilation during sleep, with a monotonous respiratory rate and shallow breathing due to reduced tidal volume; the most severely affected patients also hypoventilate while awake [8]. Polysomnography shows hypercapnia and hypoxaemia that are more severe during sleep than during wakefulness and more severe in slow-wave (NREM) sleep than in REM sleep, with reduced respiratory rate and flow amplitude, central apnoeas, and absent or low ventilatory responses to hypercapnia and hypoxia during sleep and wakefulness [7]. Patients do not increase the rate or depth of breathing in response to hypoxaemia and hypercapnia, do not arouse, and do not feel asphyxia or dyspnoea; only the youngest infants may retain some response to CO2 [8]. In neonatal presentation (first 30 days), the typical signs are cyanosis and hypercapnia in the first hours of life, apnoeas and failed extubation [8, 18]. Intercurrent illness increases requirements: a patient ventilated only during sleep may need ventilation 24 hours a day during an acute illness [7]. The French PNDS adds that spontaneous ventilation during wakefulness appears to consume cognitive resources, based on two physiological studies from 2014 in adults, and that activities requiring intense concentration may worsen hypoventilation; it therefore recommends measuring this cost in neuropsychological tests and adjusting assisted ventilation during wakefulness to the result [9].

3.4. CCHS: cardiovascular manifestations

All patients have reduced beat-to-beat heart rate variability, visible on the Poincaré plot of R-R+1 against R-R, with a “cigar” pattern instead of the normal “ice-cream cone” pattern, especially during wakefulness and REM sleep [8]. Prolonged sinus pauses occur during wakefulness and may cause syncope or staring episodes, or be asymptomatic; transient asystoles with a prolonged R-R interval are a potential cause of sudden death, and the PHOX2B genotype determines this risk [8, 67]. Syncope or fainting occurs in up to 25% of patients and may result from sinus bradycardia, transient asystole or postural hypotension [7]. Blood pressure dysregulation produces raised values at night and daytime and postural hypotension [7]. A Cincinnati series of 20 patients with a PHOX2B variant (2003–2016) found structural cardiac anomalies in 6 (30%), including atrial septal defect, patent ductus arteriosus, anomalous origin of the left coronary artery and vascular ring, mostly in patients with NPARM or gene deletion [18].

3.5. CCHS: gastrointestinal manifestations

HSCR occurs in 16% of patients according to OMIM and Orphanet and in 13–20% according to the European guideline, with a risk determined by the genotype; it usually presents in the neonatal period, but may be diagnosed later, and total intestinal aganglionosis is rare but described [7, 8, 18]. Severe constipation without HSCR, with ganglion cells present but possibly abnormal function, is the hallmark of the gastrointestinal phenotype, and oesophageal dysmotility with dysphagia, mainly for solids, appears in the first year and improves later; gastro-oesophageal reflux favours vomiting, chronic nocturnal cough and retrosternal pain [7, 8]. The French PNDS estimates HSCR at 20% of patients, mentions constipation that may progress to obstruction by faecalomas, and includes in gastrointestinal follow-up the liver injury related to hypoxic episodes and, in dental follow-up, caries favoured by reflux and swallowing disorders [9].

3.6. CCHS: ocular, autonomic, endocrine and neurological manifestations

Ocular abnormalities are present in 46–92% of patients: pupillary abnormalities with altered light response from early childhood and dependent on the genotype, bilateral miosis more frequent than mydriasis, anisocoria, hippus, convergence insufficiency, strabismus, ptosis, third nerve palsy and Marcus Gunn synkinesis [7, 8]. Other manifestations of ANSD include hypothermia and reduced basal temperature, poor heat tolerance, sporadic profuse sweating, and reduced perception of pain and anxiety [8]. Glycaemic regulation is under autonomic control: hyperinsulinism with hypoglycaemia, sometimes with seizures, hyperglycaemia, growth hormone deficiency and isolated hyperthyroidism have been described [7, 68]. Breath-holding spells with profound desaturation, seizures secondary to hypoxaemia, hypoglycaemia or arrhythmia, and syncope are the life-threatening neurological complications [7]. Intelligence quotient (IQ) at school age is variably reduced, with a mean of 85 and a standard deviation of 15, unrelated to the genotype; at preschool age, 20/25 children had a normal IQ while 20/26 and 20/27 children already had a reduced IQ, and cyanotic apnoeas, prolonged sinus pauses, ventilation 24 hours a day and seizures were associated with worse scores [8, 69, 70]. Iron deficiency may accentuate the respiratory disturbances, which is why the French PNDS includes iron studies in the annual laboratory assessment, alongside thyroid dysfunction and hyperprolactinaemia among the endocrine abnormalities to be sought [9]. The European guideline reports visual and auditory memory difficulties in about 66% of children, a formal diagnosis of learning difficulties in 30%, special educational needs in half and social interaction difficulties in 54% [7]. The quality of ventilation and oxygenation in the first years conditions neurodevelopment, and the GeneReviews authors attribute most seizures to complications of hypoventilation management [7, 8]. The facial features described include downslanting palpebral fissures, a small nose, a triangular mouth and low-set, posteriorly rotated ears, and a quantitative study described a facial pattern associated with the genotype [3, 18, 71].

3.7. CCHS: neuropathology and neuroimaging

Neuropathological findings are scarce and many older cases lacked PHOX2B confirmation: neuronal loss in the reticular nuclei and adjacent cranial nerves in one case, absence of the arcuate nucleus in another, and on magnetic resonance imaging (MRI) posterior thalamic, cerebellar, midbrain and limbic deficits, white matter abnormalities and abnormal functional MRI responses to cold, hypoxia and hyperoxia, involving the hypothalamus, caudal raphe, locus coeruleus, lateral medulla, parabrachial pons, cerebellum, insula and cingulate [8]. These changes may result from the variants or from hypoxia and perfusion changes due to suboptimal management [8]. Brain MRI is usually normal and served mainly to exclude other causes before genetic diagnosis [7].

3.8. Phenotype by PHOX2B genotype

The following table reproduces Table 2 of GeneReviews, based on Weese-Mayer 2017. In the version consulted, only the hypoventilation row has a distinct value for the recurrent 38 bp deletion; in the other rows the values are distributed across the first four columns, and the GeneReviews text confirms that the 50% NB corresponds to NPARM in general [8, 72].

The table simplifies a continuum. Patients with 20/28 to 20/33 have no column of their own; the text attributes tumours to them in less than 5%, and the GeneReviews evaluation protocol includes tumour surveillance from 20/28 onwards [8]. The 2020 European guideline extends sinus pauses to all genotypes, recommending screening in all patients, whereas the 2010 American Thoracic Society (ATS) statement associated them with long PARM [7].

3.9. LO-CCHS and carriers with reduced penetrance

LO-CCHS presents between the first month of life and adulthood, with alveolar hypoventilation during sleep and attenuated ANSD [8]. Five adults with onset after age 21 years had survived without ventilation until diagnosis, but all reported respiratory symptoms since childhood; the presentations were unexpected hypoxaemia during respiratory infection, sleep disturbances and seizures, with chronic hypercapnia, polycythaemia and right heart changes, and two had cognitive impairment attributable to chronic hypoxaemia; some children inherited the same +5 alanine expansion with onset in the first year, which illustrates the incomplete penetrance of short expansions [18]. Hypoventilation revealed by anaesthesia, sedation or antiepileptic drugs, failure of ventilator weaning after pneumonia and persistent central hypoventilation after treatment of obstructive apnoea are typical forms of presentation [7, 8]. Polysomnography of three apparently healthy parents of a child with CCHS showed sleep respiratory control abnormalities in the mother with a 5-alanine expansion and a normal pattern in the two fathers with 6-alanine mosaicism, which supports physiological evaluation of carriers [18].

3.10. Natural history and treated disease in CCHS

CCHS has evolved from a neonatal disease with high mortality to milder and more varied presentations [7]. In the French registry of 70 patients published in 2005, overall mortality was 38% (95% CI 27–49%), with a median age at death of 3 months; the median age at diagnosis fell from 3.5 months before 1995 to less than 2 weeks in the final 5 years, and CCHS was isolated in 58 patients, associated with HSCR in 9, with HSCR and a neural crest tumour in 2 and with growth hormone deficiency in 1 [5]. These values describe a historical cohort with less standardised diagnosis and ventilation and do not apply to patients treated today. With adequate artificial ventilation, many patients live into the third and fourth decades, with the potential for a normal life expectancy; deaths are associated with suboptimal ventilatory support, lack of adherence, unsupervised alcohol or drug use in ventilator-dependent adolescents and young adults, and asystoles in patients without a pacemaker or with insufficient pacemaker evaluation [8]. Quality of life measured in young adults appears only moderately reduced [7].

3.11. Neuroblastoma in predisposition syndromes

In Costello syndrome, malignant tumours occur in 10–15% by age 20 years according to Smith, mainly rhabdomyosarcoma, followed by NB in early childhood and transitional cell carcinoma of the bladder in adolescence, and GNB is an occasional abnormality; AACR 2024 gives a 15–20% cancer risk, and the age and location of NB do not differ from the general population, with more than 80% in the adrenal glands and paravertebral chain and an absolute risk of thoracic NB below 1% [2, 11, 73]. Patients with Costello syndrome often have raised urinary catecholamine metabolites without a tumour, for unknown reasons [2, 11]. In Weaver syndrome, leukaemia, lymphoma, sacrococcygeal teratoma and endodermal sinus tumour of the ovary have been described, but NB is the only tumour with a proven increased incidence, and the lifetime risk of malignancy is unknown [58, 74]. In BWS, embryonal tumours occur in about 8% of children, mostly by age 8 years, and NB accounts for 10% of tumours; the frequency varies with the mechanism: 0.5% in IC2 loss of methylation, 0.7% in IC1 gain of methylation, 1.4% in segmental paternal uniparental disomy and 4.2% in CDKN1C variants [10, 75]. In the 2p24.3 microduplication involving MYCN, the tumours are NB and Wilms tumour [2, 12]. In MPAPA, NB arose in infancy in the three patients described, with a good response to chemotherapy and surgery in two [32]. NB has been described occasionally in Simpson-Golabi-Behmel syndrome (5–15% risk for a group of embryonal tumours, X-linked, GPC3), in Noonan syndrome with multiple lentigines, in Rubinstein-Taybi syndrome and in Fanconi anaemia; none of these entities has recommended NB surveillance [2, 76–79].

3.12. ROHHAD

ROHHAD begins between 1.5 and 10 years, mostly between 2 and 7, in a previously healthy child of normal build, with dramatic weight gain over 3 to 12 months, followed by hypothalamic dysfunction (altered water balance, hyperprolactinaemia, central hypothyroidism, altered puberty, growth hormone deficiency, ACTH insufficiency), central alveolar hypoventilation during sleep, often preceded by obstructive apnoea, and later during wakefulness, and ANSD (thermoregulation, sweating, pupillary response, peripheral vasomotor function, bradycardia) [8, 13]. Behavioural problems range from mild to severe, especially with inadequate ventilation, and the phenotype “unfolds” with age [8]. Mature neuroblastic tumours (GN and GNB, rarely NB) occur in about 40% according to GeneReviews and in at least 40–50% according to AACR 2024 [2, 8, 80]. There are no PHOX2B variants and no gene has been identified by trio exome sequencing, monozygotic twins and tumours, nor in the hypocretin and hypocretin receptor genes [8, 16]. With rigorous management, the GeneReviews authors observed recovery of spontaneous breathing during wakefulness [8]. Orphanet records 96 published cases [13].

4. Clinical Recognition and Red Flags

4.1. When to suspect neuroblastoma predisposition

Suspicion of germline predisposition arises in three contexts: a family history of neuroblastic tumour (NB, GNB or GN), bilateral or multifocal primary tumours, synchronous or metachronous, and features of an associated syndrome [2, 3, 16]. A fourth context is laboratory-based: detection, on somatic tumour testing, of a pathogenic or likely pathogenic variant that would be predisposing if it were germline, such as an activating ALK variant [2, 3]. In the family, benign and malignant tumours may coexist, and a mature GN in a parent has the same familial significance as an NB in a child [3, 4]. Multifocal perinatal or congenital NB accompanied by encephalopathy, brainstem abnormalities or hypoventilation, without a PHOX2B variant, should prompt testing of the ALK hotspots [47, 48]. The association of NB with HSCR, central hypoventilation or oesophageal dysmotility suggests PHOX2B [3, 34]. The syndromic signs to look for are overgrowth with macroglossia, omphalocele or hemihyperplasia (BWS), overgrowth with a broad forehead, hypertelorism and long philtrum (Weaver), coarse facial features with growth deficiency, characteristic skin and hair and heart disease (Costello), megalencephaly with postaxial polydactyly (MPAPA), and rapid-onset obesity with hypothalamic dysfunction (ROHHAD) [3, 13, 32].

4.2. When to suspect CCHS in the newborn

In the newborn, CCHS should be considered in the presence of unexplained shallow breathing, with adequate ventilation during wakefulness and hypoventilation during sleep or hypoventilation during both wakefulness and sleep; of abnormal ventilatory drive, with absent or attenuated response to hypercapnia and hypoxaemia, absence of arousal despite compromise, and absence of perception of asphyxia and dyspnoea; and of ANSD, with severe cyanotic apnoeas, absent response to exercise and stress, altered perception of anxiety, oesophageal dysmotility, severe constipation without HSCR, profuse sweating, reduced basal and peripheral skin temperature and diminished pupillary response [8]. Suspicion presupposes the absence of primary neuromuscular, pulmonary or cardiac disease and of a brainstem lesion that would explain the picture [8]. Frequent apnoeas and desaturations unresponsive to caffeine in a preterm infant, beyond what is expected from immaturity, were the presenting sign of the case in section 10 [48]. The European guideline recommends investigating CCHS in any child with unexplained central hypoventilation, in patients with hyperinsulinism associated with hypoventilation and in any child of a parent with CCHS [7]. The French PNDS describes as typical neonatal circumstances poor respiratory adaptation at birth, desaturation or hypercapnia with bradypnoea and without signs of respiratory distress, unexplained and recurrent severe cyanosis, severe apparent life-threatening events, severe central apnoeas and an unexplained need for ventilation; what leads to the diagnosis is the persistence of hypoventilation or ventilator dependence without a cardiac, neurological or muscular cause [9]. The discovery of HSCR, especially long-segment (right colon or total colonic aganglionosis), should prompt investigation for associated CCHS [9].

4.3. When to suspect LO-CCHS, from childhood to adulthood

From childhood to adulthood, the red flags are shallow breathing during sleep, apparent life-threatening events and cyanosis during sleep with unexplained nocturnal hypercapnia and hypoxaemia, central alveolar hypoventilation persisting after treatment of obstructive apnoea, apparent indifference to hypercapnia and hypoxaemia (prolonged underwater swimming, voluntary breath-holding, severe pneumonia), slow “recovery” from a severe respiratory illness, recurrent severe infections with hypoventilation, failure to wean from the ventilator without intrinsic lung disease, and hypoventilation, with very high exhaled CO2, triggered by antiepileptic drugs, sedation, anaesthesia or intercurrent illness [8]. Sudden unexpected death in infancy or childhood, especially with a family history of CCHS or sudden death, unexplained seizures, neurocognitive delay with previous cyanosis and the characteristic facial features complete the list [8]. The European guideline adds adults with unexplained central hypoventilation during sleep and the parents of children with CCHS, who should be tested [7]. Patients with BRUE or central apnoeas should undergo at least one prolonged, continuous CO2 monitoring before PHOX2B testing is discussed, which is not indicated in apnoeas or BRUE without hypoventilation [7]. The French PNDS adds to this list coma or altered consciousness during an infection or after sedatives, delayed awakening after anaesthesia, chronic hypercapnia or pulmonary hypertension not explained by cardiac or respiratory disease, and malaise or loss of consciousness during breath-hold swimming or a stay at altitude; at these ages, presentations are often misleading and require extensive investigation [9]. In the family investigation of a carrier, targeted questioning sometimes reveals respiratory symptoms or episodes of malaise that had previously been ignored or underestimated [9].

4.4. Tumour and emergency warning signs

Families of children under surveillance should know the signs of NB: abdominal mass or pain, opsoclonus-myoclonus or ataxia, subcutaneous nodules, watery diarrhoea with abdominal distension, and periorbital ecchymosis [2]. Physical examination of a carrier includes abdominal palpation and a search for Horner syndrome and skin lesions [3]. In CCHS, emergencies are acute respiratory deterioration (cardiorespiratory arrest, severe hypoxaemia, unresolved accidental decannulation, stoma bleeding), any alteration of consciousness and syncope; carers should recognise these situations and act before arrival at hospital, and emergency services should know the patient and their ventilation requirements [7]. Giving oxygen alone to a patient with CCHS who is hypoventilating improves saturation but may worsen hypoventilation and cause acidosis and coma; the appropriate response is ventilation [7, 8]. An unexpected prolongation of the need for mechanical ventilation after sedation or anaesthesia may be the first manifestation of a mild form [7]. The French PNDS summary for the attending physician sets out four emergency rules: desaturation below 90% on oximetry, even without symptoms, is a major sign of a medical event whose cause must be sought and treated immediately; fever and respiratory signs (dyspnoea, cough, respiratory effort) may be absent during infections; antibiotic therapy should be early and almost systematic in the presence of infection; and in the event of desaturation the patient should be placed on mechanical ventilation, never on oxygen alone, because of the risk of hypercapnic coma [9].

4.5. Population screening and newborn screening

Mass screening of infants by urinary catecholamine metabolites, carried out in Japan, in Quebec (476,654 children born between 1989 and 1994, with 92% uptake) and in Germany (1,475,773 children screened at 1 year of age), detected many more NB than expected, many of which would have regressed or differentiated, without reducing the incidence of high-risk NB after the first year or mortality [2, 14, 16]. Population screening is therefore not appropriate in average-risk infants, and carrier surveillance differs in being continuous until age 10 years in a high-risk population [2, 16]. There is no routine newborn screening for ALK or PHOX2B variants. A retrospective study of neonatal dried blood spots from 1948 Michigan children with a solid or central nervous system tumour by age 8 years (birth cohort 1987 to 2020) found pathogenic or likely pathogenic variants in an 11-gene panel in 6.8%, one of them in PHOX2B and none in ALK among the carriers reported, and estimated that about 1 in 27,000 newborns develops an early neoplasm associated with one of these variants; the panel was designed for single-nucleotide variants, small insertions and deletions and copy number, and not for the polyalanine expansions [81]. This is research, not an implemented programme.

5. Diagnosis: Criteria, Testing and Algorithms

5.1. Diagnosis of the neuroblastic tumour

NB, GNB and GN are defined histologically; GNB behaves in a benign or aggressive manner depending on histology [3]. Staging follows the International Neuroblastoma Risk Group (INRG) system and risk stratification combines age, stage and tumour biology, including MYCN amplification, the genomic alteration with the worst prognosis [3, 45, 48]. Iodine-123-labelled metaiodobenzylguanidine (MIBG) scintigraphy, approved by the US Food and Drug Administration (FDA) as Adreview® in 2008 for detection of phaeochromocytomas and primary or metastatic NB, forms part of staging and response assessment [82, 83]. In patients with predisposition, the initial evaluation of a tumour does not differ from that of a sporadic tumour; the difference lies in the active search for other primaries and in genetic counselling [3].

5.2. Urinary biomarkers and interference

The urinary catecholamine metabolites, vanillylmandelic acid (VMA) and homovanillic acid (HVA), are measured by gas chromatography-mass spectrometry (GC-MS) and expressed normalised to creatinine; a 24-hour urine collection is not required, and a normalised spot sample suffices [2, 16]. In the case in section 10, the values at diagnosis were dopamine/creatinine 1790 nmol/mmol, HVA/creatinine 189 µmol/mmol (reference below 20) and VMA/creatinine 300 µmol/mmol, with reference ranges printed ambiguously in the article [48]. In Costello syndrome, the metabolites are frequently raised without a tumour, and AACR 2024 and the RASopathy update advise against their use in surveillance [2, 11]. Several causes alter the interpretation of urinary organic acids and amino acids: urinary vanillactic acid increases with bananas, with carbidopa, in NB and in aromatic L-amino acid decarboxylase deficiency, and raised urinary cystathionine occurs in prematurity, vitamin B6 deficiency, homocysteine remethylation defects and NB (NB cystathioninuria) [84, 85].

5.3. Indications for germline testing

AACR 2024 recommends germline testing in patients with bilateral or multifocal NB or a family history of NB, and when somatic testing reveals a variant that would be predisposing if germline; in the presence of a germline variant, cascade testing begins with the parents, and classification follows the criteria of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG/AMP) [2]. GeneReviews grades the indications for ALK based on Bourdeaut 2012, Brodeur 2017 and Kamihara 2024 [3, 28, 29]:

The probability of a germline ALK variant in families with at least two first-degree relatives with NB is about 80%, and much lower when the affected individuals are second-degree or more distant relatives [3, 23]. Routine germline ALK testing in all NB is not standard, given that predisposition gene variants occur in 1–2% of patients [3]. Some institutions test ALK in all tumours, others at relapse or progression, with the aim of guiding targeted therapy and not of identifying carriers [3]. AACR 2017 recommends considering predisposition gene testing in any patient with NB and a family history, bilateral or multifocal tumours, or features of the associated syndromes, and AACR 2024 cites the MIPOGG algorithm, evaluated retrospectively for genetic referral of children with neuroblastic tumours [2, 16]. Broad germline sequencing of 786 patients found pathogenic or likely pathogenic variants in cancer predisposition genes in general in 13.9%, which indicates that broad panels reveal findings outside the NB genes, with their own counselling consequences [60].

5.4. ALK testing: methods and limits

Testing may be single-gene (ALK sequencing) or a multigene panel including ALK and the genes of the differential diagnosis; sequencing detects all known pathogenic variants, and deletion/duplication analysis is not indicated, because the mechanism is gain of function and no large deletions or duplications have been described [3]. The diagnosis requires an activating heterozygous germline variant, pathogenic or likely pathogenic, in the tyrosine kinase domain, known or suspected to alter kinase function; a variant of uncertain significance (VUS) neither establishes nor excludes the diagnosis [3]. Distinguishing a germline from a somatic variant requires DNA from non-tumour tissue; a variant allele fraction (VAF) close to 50% in the tumour suggests but does not prove germline origin, because 2p gains in the tumour alter this fraction, as in the case in section 10, in which the ALK VAF was 70% in a sample with 2p gain [48]. Testing of the parents confirms de novo origin; parental leukocytes do not detect germline mosaicism [3, 48]. Variants listed as predisposing in 2017 (I1183T, L1204F) are now germline VUS in ClinVar, and somatic oncogenicity classification should not be transposed to the germline report [16, 42].

5.5. CCHS criteria and physiological evaluation

The diagnosis of CCHS is established in a patient with suggestive findings and a heterozygous pathogenic or likely pathogenic PHOX2B variant [8]. The 2010 ATS statement considers the PHOX2B variant necessary to confirm the diagnosis, and the 2020 European guideline gives PHOX2B variants in about 90% of patients with CCHS [7, 86]. The blood gas criteria are age-defined: sleep hypoventilation in children is defined by a partial pressure of CO2 (PCO2) above 6.7 kPa (50 mmHg) for more than 25% of total sleep time; the normal values considered are an arterial CO2 pressure (PaCO2) of 4.7–6.0 kPa (35–45 mmHg) and an arterial oxygen saturation (SaO2) of 95% or more [7]. At diagnosis, spontaneous ventilation should be assessed in REM sleep, NREM sleep and wakefulness, under medical supervision, to estimate severity in each state [7]. The initial evaluation in an experienced paediatric respiratory physiology laboratory includes study of spontaneous breathing awake and asleep, with tidal volume, thoracic and abdominal inductance plethysmography, oximetry with pulse waveform, exhaled CO2 with visible waveform, electrocardiogram (ECG), blood pressure, cerebral regional blood flow and oxygenation and sleep staging, responses to hypercapnic and hypoxaemic challenges, blood gas or serum bicarbonate, haemoglobin, haematocrit and reticulocytes (polycythaemia), 72-hour Holter monitoring (asystoles), echocardiography (right ventricular hypertrophy, cor pulmonale), baseline neurocognitive assessment, autonomic testing (pupillometry, tilt table, sweating in a thermoregulatory chamber, heart rate with deep breathing, Valsalva manoeuvre, orthostatic test) and a genetics clinic appointment [8]. The autonomic evaluation should cover the cardiovascular, gastrointestinal and ocular systems and the metabolic and endocrine status, including 24-hour glucose monitoring and an oral glucose tolerance test, and investigation for neural crest tumours is discussed according to age and genotype [7]. The French PNDS defines the diagnosis by the combination of two major criteria, hypoventilation of central origin or apnoeas during sleep or wakefulness and the presence of a PHOX2B variant, recognises attenuated forms with moderate hypercapnia and considers a long-duration polysomnography in a reference centre, with a test of the ventilatory response to hypercapnia if available, indispensable at diagnosis [9]. Severity in the neonatal period is assessed by the extent of dysautonomia (long-duration Holter, oesophageal impedance or pH monitoring, oesophageal manometry if available, glucose profile) and by comorbidities (HSCR, tumour-risk genotype, lesions on brain MRI); for later diagnosis, blood gases, pulmonary function tests, Holter, ambulatory blood pressure monitoring, echocardiography, upper gastrointestinal endoscopy if reflux is refractory to treatment, and ophthalmological (strabismus, convergence), neurological and neuropsychological, endocrine and metabolic, speech therapy and psychomotor assessment are added [9]. At the end of the diagnosis and initial evaluation, the PNDS requires a multidisciplinary consultation meeting to establish severity, vital and functional prognosis and the therapeutic plan [9].

5.6. PHOX2B testing: algorithm, sensitivity and limits

CCHS testing is single-gene, because most next-generation sequencing panels do not detect the polyalanine expansions, the most common variants [8]. The ATS proposed a stepwise test, adopted by GeneReviews:

The proportion of probands with a detected variant is 90–92% by targeted expansion analysis, 8–10% by sequencing and less than 1% by deletion/duplication analysis [8, 87]. These values are proportions of known variants by method and not clinical sensitivity: the overall detection rate in a French cohort of 188 probands was 92.6% [18, 54]. GC-rich regions require specific amplification techniques, and the largest expansions tend to escape amplification [7]. The larger PARM would be detected by exome sequencing, but may not be detected by panels [16]. A negative panel or exome result does not exclude CCHS, and a negative sequencing result in a parent does not exclude low-level mosaicism. The report should state the gene, the transcript and its version (NM_003924.4), the HGVS notation, the 20/N genotype, the zygosity, the ACMG/AMP class and the method, so that correlation with the table in section 3.8 is possible. A PHOX2B VUS neither establishes nor excludes the diagnosis; the GeneReviews authors offer to review VUS with clinicians [8]. When a PARM is identified and the phenotype is more severe than expected, the gene should be sequenced in search of a second variant [18, 53].

5.7. Testing of parents and relatives in CCHS

Once the variant has been identified in the proband, testing should be offered to both parents with methods able to detect low-level mosaicism (fragment analysis), which allows a reliable recurrence risk and identifies parents at risk of LO-CCHS; mosaic parents should have a complete physiological evaluation [7, 8, 86]. The family history is only considered negative after appropriate molecular testing and physiological evaluation of the parents [8].

5.8. Testing for the other entities

The 2p24.3 microduplication requires copy-number analysis by microarray or genome sequencing, and Taylor and colleagues propose testing for it routinely when predisposition to Wilms tumour or NB is suspected [12]. The MYCN variants of MPAPA were identified by trio exome sequencing and confirmed by Sanger sequencing [32]. CDKN1C, HRAS and EZH2 are studied by sequencing; BWS requires characterisation of the 11p15 molecular mechanism [3, 10]. In ROHHAD there is no germline test, and a negative PHOX2B result in a patient with rapid-onset obesity and hypothalamic dysfunction supports the clinical diagnosis [2, 8].

5.9. Practical algorithm

In the presence of a neuroblastic tumour, the first step is a three-generation family history, looking for NB, GNB, GN, HSCR, hypoventilation and sudden death, and an examination targeted at syndromic signs. If there is an affected first-degree relative, bilateral or multifocal tumours or a somatic ALK variant, germline sequencing of ALK and PHOX2B on a panel follows, with 2p24.3 copy-number analysis if the panel allows it; in the presence of HSCR, hypoventilation or autonomic dysfunction, PHOX2B fragment analysis is added [2, 3, 8, 12]. In the presence of central hypoventilation in a newborn, the sequence is fragment analysis, sequencing and deletion analysis of PHOX2B; if these are negative and NB is present, testing of the ALK hotspots; if still negative and there is consanguinity, MYO1H and LBX1 [7, 8, 48]. The European guideline publishes a diagnostic algorithm for alveolar hypoventilation that integrates polysomnography, MRI, electromyography and conduction studies to exclude neuromuscular causes, and PHOX2B and ROHHAD [7]. The decision trees of the French PNDS call for genetic testing once neonatal infection and bronchopulmonary and cardiac causes have been excluded, with no evidence of muscle or metabolic disease and a brain MRI without an explanatory lesion; in a transportable newborn, a complete long-duration polysomnography with PCO2 is performed, and in an intubated and ventilated newborn a prolonged recording of SpO2 and transcutaneous PCO2; in children and adults, the complete long-duration polysomnography with PCO2 includes, if available, the test of the ventilatory response to CO2 [9].

5.10. Prenatal and preimplantation diagnosis

Once the familial variant has been identified, prenatal diagnosis and preimplantation genetic testing (PGT) are possible for ALK and for PHOX2B [3, 8]. In CCHS, because of the high frequency of parental mosaicism, the fetus should be considered at risk even when the proband’s variant was not detected in the parents, and the European guideline advises prenatal testing in all families with a child with CCHS, whether or not the parents are carriers [7, 8]. Prenatal diagnosis is also valuable for planning delivery in a centre able to initiate ventilation, regardless of any decision about continuing the pregnancy [7]. The fetal ultrasound findings of ventriculomegaly, macrocephaly and postaxial polydactyly led to the diagnosis of MPAPA in a fetus at 31 weeks of gestation [32].

6. Differential Diagnosis

6.1. Genetic differential diagnosis of neuroblastoma with suspected predisposition

The following table brings together the entities in the differential diagnosis of the ALK GeneReviews, those of AACR 2024 and those described in the reference textbooks.

The sources agree that ALK is the main cause in otherwise healthy individuals and that PHOX2B explains most of the remaining families, almost always with a neural crest developmental disorder [2, 3]. The most frequent distinction in practice is between a germline and a somatic ALK variant, because isolated sporadic NB often contain a somatic variant absent from the germline, with no hereditary implication [3]. The 2p24.3 duplication and MPAPA are distinguished by context: the former by embryonal tumours without specific malformations and with low penetrance, the latter by the brain and limb malformation phenotype with NB in infancy [12, 32]. The BWS, Costello and Weaver genes are identified by the overgrowth phenotype or the facial features, and their tumour management is dominated by other tumours [2, 3, 11]. Somatic 1p36 deletion, frequent in NB, is a tumour finding without germline implication, although a constitutional interstitial 1p36 deletion has been described in a child with dysmorphic features and NB at 5 months [14, 62]. A family with NB in childhood, extra-adrenal phaeochromocytoma, paragangliomas and renal cell carcinoma revealed an SDHB variant, which places hereditary paraganglioma in the differential diagnosis when there are phaeochromocytomas in the family [14]. Among the entities in the reference textbooks, LFS has a strong association with sarcomas, breast cancer, brain tumours and adrenocortical carcinoma, a moderate one with pancreatic and gastric cancer and a weak one with leukaemias and NB [63].

6.2. Differential diagnosis of central hypoventilation in the newborn and child

The practical rule is that CCHS is a diagnosis of exclusion of neuromuscular, pulmonary, cardiac and brainstem disease, confirmed by PHOX2B [7, 8]. ROHHAD is the most important differential diagnosis in the older child, because it also presents with hypoventilation, dysautonomia and neuroblastic tumours; it is distinguished by the initial period of normal development, the rapidly developing obesity and the hypothalamic dysfunction, and has no PHOX2B variants [3, 8, 16]. Hypoventilation in a newborn with multifocal NB without a PHOX2B variant should suggest a highly activating germline ALK variant [47, 48]. The central hypoventilation described in pyruvate dehydrogenase complex deficiency, pontocerebellar hypoplasia type 4 and the respiratory patterns of Rett syndrome and cerebellar anomalies, in which hyperventilation alternates with apnoeas or hypoventilation during wakefulness, form part of the metabolic and neurological differential diagnosis [18, 88–92]. Central hypoventilation can also be a feature of other developmental disorders, such as those caused by MECP2 [18]. There are central hypoventilations with no identified variant and no structural abnormality on brain MRI, which the French PNDS states should be managed in the same way as CCHS; the same document estimates ROHHAD at fewer than one thousand cases worldwide, with a severe prognosis and high mortality [9].

6.3. Imaging differential diagnosis of the adrenal mass in infancy

The diffuse adrenal calcifications that follow the outline of the glands in Wolman disease are distinguished from the calcifications of adrenal haemorrhage and those of NB [93]. For a mass detected during surveillance, the AACR proposes contrast-enhanced MRI, and MRI replaces ultrasound when the latter is technically inadequate [2].

7. Treatment and Risk Management Strategies

7.1. Principles of tumour treatment in the predisposition carrier

The neuroblastic tumour of a germline carrier is treated with standard risk-stratified therapy, by paediatric oncology in a paediatric oncology centre [3]. Depending on age, stage and biology, NB and GNB may be observed only or resected; tumours with metastatic risk or that have metastasised require chemotherapy and, sometimes, radiotherapy, haematopoietic stem cell transplantation (HSCT) and immunotherapy; GN are treated by surgical resection without other therapy [3]. There is no evidence of greater sensitivity to chemotherapy or radiotherapy in ALK carriers, and medical and surgical management is the same as in the general population [3]. Two particular features of predisposition change management: the possibility of multiple primary tumours, which justifies continuing surveillance after treatment of a first tumour, and, in patients with PHOX2B variants, the need to adapt anaesthesia, surgery and chemotherapy to hypoventilation and autonomic dysfunction [3, 94]. In CCHS, NB are removed surgically and followed by chemotherapy if they exceed stage 1, and other neural crest tumours are treated according to location and type, with surgical removal recommended even for benign tumours [8]. The first published case of high-risk NB in a child with CCHS, HSCR and PARM 20/33 was treated with chemotherapy and therapeutic iobenguane (131I-MIBG), and the authors stressed the need to individualise treatment according to comorbidities [94]. The European guideline allows for a more intensive therapeutic approach in CCHS tumours and refers the type and frequency of evaluations to local oncology protocols [7].

7.2. ALK inhibitors: rationale and evidence in the germline carrier

ALK inhibitors have no role in the unaffected germline carrier, and trial eligibility depends on the ALK status of the tumour and not on the germline variant [40]. The trials were not specific to germline carriers, but included small numbers with good responses [3]. In the phase 1 crizotinib trial, one patient with germline p.(Arg1275Gln) had a complete response, at a dose of 365 mg/m² higher than the recommended dose, and another had prolonged stable disease with resolution of the MIBG lesions [95, 96]. In the phase 1 lorlatinib trial of the NANT (New Approaches to Neuroblastoma Therapy) consortium, NANT2015-02, the only patient with a germline variant (p.(Arg1275Gln)), with primary refractory metastatic NB treated at the lowest dose level (45 mg/m²), had a partial response with a complete marrow response in cycle 2 and a near-complete response by the Curie MIBG score, completed 18 cycles and came off protocol because of significant weight gain; the authors consider this proof of concept of the efficacy of ALK inhibition in the germline setting [83]. In a 2026 Chinese series, one of the variants treated was a germline p.(Arg1275Gln) [97]. GeneReviews summarises responses of small groups of carriers in crizotinib and ceritinib studies; the counts it presents cannot be reliably attributed to each study and are not reproduced here [3].

Sensitivity depends on the variant. At steady state, crizotinib reaches a mean free concentration of about 129 nM, equivalent to the 50% inhibitory concentration of p.(Phe1174Leu) (130 nM) and slightly above that of p.(Arg1275Gln) (85 nM), which explains the primary resistance of the F1174 and F1245 variants [95]. In the NB cohort of the COG ADVL0912 trial, the three responses occurred with somatic p.(Arg1275Gln), the three patients with p.(Phe1174Leu) progressed in the first cycle and the two with ALK amplification did not respond [95]. Lorlatinib produced responses in all hotspot variants (F1174, F1245, R1275) and in patients with a prior ALK inhibitor, but 6 of 7 patients younger than 18 years with MYCN amplification progressed by the end of cycle 2 [83]. In the Chinese series, the response rate was 100% in tumours with a hotspot variant without MYCN amplification and 25.0% with MYCN amplification, rare variants or ALK amplification (p = 0.006), and acquired resistance was associated with BRAF fusions, MET amplification and NF1 variants, without functional validation [97].

7.3. Dosing and safety of ALK inhibitors

All uses of these drugs in NB are off-label or within a clinical trial: no ALK inhibitor has an approved indication for NB in the USA or the EU [98, 99, 103–105]. Lorlatinib combined with anti-GD2 antibodies caused severe pulmonary toxicity: in a retrospective review of 29 patients treated at Memorial Sloan Kettering Cancer Center (MSKCC) between 2020 and 2024, 4 of 20 patients with concomitant administration had grade 3 or higher pulmonary toxicity, 2 with respiratory failure, haemodynamic instability, mechanical ventilation and extracorporeal membrane oxygenation, all of whom recovered; after 11/2023, with lorlatinib withheld during antibody cycles, none of 15 patients had grade 3 or higher toxicity [106]. The same toxicity was noted in ANBL1531 with concomitant dinutuximab, and the Chinese series describes pulmonary toxicity with lorlatinib combined with anti-GD2 or with chemotherapy [97, 106].

7.4. Other high-risk NB drugs relevant to the carrier

Eflornithine (Iwilfin®), an ornithine decarboxylase inhibitor, has been FDA-approved since 13-12-2023 to reduce the risk of relapse in adults and children with high-risk NB who have had at least a partial response to multimodal therapy including anti-GD2 immunotherapy [82, 107]. The dose is oral, twice daily, adjusted to body surface area, for up to 2 years, progression or toxicity: 768 mg (4 tablets of 192 mg) above 1.5 m², 576 mg between 0.75 and 1.5 m², 384 mg between 0.5 and less than 0.75 m² and 192 mg between 0.25 and less than 0.5 m², with recalculation of body surface area every 3 months and a 50% reduction if the estimated glomerular filtration rate is below 30 mL/min; the tablets may be swallowed, chewed or crushed with soft food or liquid [107]. Before starting, an audiogram, full blood count and liver function tests are performed; adverse effects of at least 5% include hearing loss (11%), otitis media (10%), fever (7%), pneumonia and diarrhoea, and the most frequent grade 3–4 laboratory abnormalities are raised transaminases, neutropenia and anaemia [107]. In the EU, Norgine withdrew the marketing authorisation application for Ifinwil on 18-07-2025 after a provisional negative opinion from the European Medicines Agency (EMA), which considered efficacy not demonstrated owing to design limitations and uncertainties in the conduct and results of the main study of 140 children and young people without a comparator, and raised quality and manufacturing concerns [108].

Dinutuximab beta (Qarziba®), an anti-GD2 antibody, has had European marketing authorisation since 08-05-2017 as an orphan medicine for high-risk NB from 12 months of age, after induction with at least a partial response, myeloablative therapy and transplantation, and for relapsed or refractory NB, combined with interleukin-2 in relapsed, refractory or non-complete-response patients [109]. In the USA it has orphan designation without approval for NB [82]. Dinutuximab (Unituxin®) has been FDA-approved since 10-03-2015, combined with granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-2 and 13-cis-retinoic acid, in children with high-risk NB with at least a partial response to first-line therapy; in the EU it was authorised in 2015 and withdrawn in 2017 [82, 110]. Naxitamab (Danyelza®), combined with GM-CSF, has been FDA-approved since 25-11-2020 for patients aged at least 1 year with relapsed or refractory high-risk NB in bone or bone marrow with a partial or minor response or stable disease; the sources consulted do not include a European decision on naxitamab [82]. The dosing of anti-GD2 antibodies is that of the labels. Dinutuximab beta (Qarziba®, EU) is given in 5 consecutive 35-day courses, with 100 mg/m² per course, as a continuous infusion of 10 mg/m²/day for the first 10 days (240 hours) or as five daily infusions of 20 mg/m² over 8 hours on days 1–5; when combined, interleukin-2 is given subcutaneously at 6 × 10⁶ IU/m²/day in 2 periods of 5 days (the first 7 days before the antibody and the second on days 1–5); each course requires oximetry >94% on room air, neutrophils ≥500/µL, platelets ≥20,000/µL, haemoglobin >8.0 g/dL, ALT/AST <5 times the upper limit of normal and creatinine clearance >60 mL/min/1.73 m²; it applies to patients from 12 months of age and the label defines no dose beyond 100 mg/m² per course [109]. Dinutuximab (Unituxin®, USA) is given, in children with high-risk NB, at 17.5 mg/m²/day intravenously over 10 to 20 hours for 4 consecutive days, for a maximum of 5 cycles, starting at 0.875 mg/m²/hour for 30 minutes and increasing up to 1.75 mg/m²/hour as tolerated, combined with GM-CSF, interleukin-2 and 13-cis-retinoic acid, with premedication and hydration [111]. Naxitamab (Danyelza®, USA) is given at 3 mg/kg/day (maximum 150 mg/day) intravenously on days 1, 3 and 5 of each cycle, with subcutaneous GM-CSF at 250 µg/m²/day on days −4 to 0 and 500 µg/m²/day on days 1–5; cycles are repeated every 4 weeks until complete or partial response, followed by 5 further cycles every 4 weeks, and may then be repeated every 8 weeks [112]. The restrictions of each drug and the schedules for interruption due to toxicity follow these labels and the centre’s protocol. These drugs are not specific to predisposition; they are relevant to the carrier because combination with lorlatinib alters the toxicity profile [106].

7.5. Regulatory status in the USA and the EU

[82, 98, 99, 103–105, 107–110, 113, 114]

The FDA orphan designation database has 51 designations whose text includes “neuroblastoma”, of which 4 led to approval for that indication (dinutuximab, eflornithine, iobenguane 123I and naxitamab), 4 were withdrawn or revoked (among them that of entrectinib, on 07-01-2020) and 43 remain designated without approval, including crizotinib and, since 24-10-2024, chimeric antigen receptor T cells (CAR-T) targeting PHOX2B (“PHOX2B PC-CAR T”); lorlatinib and neladalkib have no orphan designation whose text contains “neuroblastoma” [82]. There is no FDA orphan designation with the terms “hypoventilation” or “Ondine”, which reflects the absence of targeted pharmacological therapy for CCHS, without excluding designations worded with other terminology [82]. The European SmPCs match the FDA labels for the doses in the table in section 7.3: lorlatinib (Lorviqua®) 100 mg once daily in adults, with reductions to 75 mg and 50 mg and permanent discontinuation if 50 mg is not tolerated; crizotinib (Xalkori®) 250 mg twice daily in adults and 280 mg/m² twice daily in children aged 1 to less than 18 years with relapsed or refractory ALK-positive anaplastic large cell lymphoma or inflammatory myofibroblastic tumour [104, 105]. The doses used in NB (lorlatinib 115 mg/m² or 150 mg; crizotinib 280 or 165 mg/m² twice daily; ceritinib 500–510 mg/m²) are trial doses, with no maximum dose defined outside the trial, and outside the label conditions.

7.6. Clinical trials with ALK inhibitors and maintenance therapy

[83, 95–97, 100, 101, 106, 107, 114, 115]

ALK inhibitor trials in NB are phase 1 trials or series without a comparator, with populations heterogeneous in variant, MYCN amplification, prior treatment and age, and response rates are not comparable between studies. The response of adults to lorlatinib (47%) was higher than that of children on monotherapy (13%), with wide and overlapping confidence intervals, and the definition of response followed the NANT 2.0 criteria, which include minor response [83]. Figure 4 of the article, with waterfall plots of the best change in Curie MIBG score by cohort (consulted at https://pmc.ncbi.nlm.nih.gov/articles/PMC10202811/figure/Fig4/), shows in each cohort patients with a 100% reduction in uptake alongside patients with progression, including, in the paediatric monotherapy cohort, patients with stable disease and complete reduction of MIBG uptake, which illustrates the difference between MIBG response and overall response [83]. The efficacy of eflornithine derives from a comparison with an external control and not from a randomised trial; sensitivity analyses gave HRs of 0.43 to 0.59 for event-free survival and of 0.29 to 0.45 for overall survival, and this was the limitation underlying the provisional negative European opinion [107, 108]. An HR of 0.48 represents a relative reduction in the risk of an event that should be read with the absolute rate in the control group, which is not given in the sources consulted. Among the studies closed without a favourable result are the lorlatinib real-world registry, terminated for operational reasons, and a phase 1 study of personalised therapy (NCT02780128), also terminated; the orphan designation of entrectinib for NB was withdrawn [82, 114]. No published data evaluate the effect of ALK inhibitors specifically in germline carriers.

7.7. Developments in the last 12 months (October 2025 to October 2026)

The search for efficacy results from the lorlatinib arm of ANBL1531 was negative, which does not exclude data presented at congresses [115]. The preliminary data for neladalkib in ALK-positive solid tumours outside NSCLC, presented in 2025, did not include NB-specific information in the sources read [113]. None of the developments alters the carrier surveillance protocol; the closest to practice is the recommendation to withhold lorlatinib during anti-GD2 immunotherapy, which derives from a retrospective single-centre series [106].

7.8. CCHS: principles of ventilatory management

No drug increases ventilation sufficiently and sustainably to make assisted ventilation unnecessary in CCHS; ventilatory support is lifelong, without weaning attempts, and should prevent the consequences of hypoventilation, even when mild, particularly on neurodevelopment [7]. The aim is to secure a safe airway and chronic home artificial ventilation, with a multidisciplinary team of paediatric respiratory medicine, sleep medicine, cardiology, oncology, ophthalmology, gastroenterology, neurodevelopmental psychology and neurology [8, 86]. Oxygen alone improves PaO2 and cyanosis but may worsen hypoventilation, and GeneReviews stresses that it is not a treatment for hypoventilation [7, 8]. Continuous monitoring of peripheral oxygen saturation (SpO2) and end-tidal (PETCO2) or transcutaneous CO2 should cover all sleep and periods of wakefulness, in hospital and at home, whatever the mode of ventilation, with continuous observation by a nurse or carer trained in ventilation and life support, especially during sleep [7, 8].

The two guidelines diverge on targets. The 2020 European guideline sets as targets a PCO2 of 35–45 mmHg (4.6–6.0 kPa) and an SpO2 of 95% or more; the 2010 ATS statement considered an end-tidal CO2 of 30–50 mmHg reasonable and a PCO2 of 35–40 mmHg ideal, with SpO2 of 95% or more [7]. Some authors have proposed mild hyperventilation during sleep (PCO2 of 30–35 mmHg) to improve gas exchange the following day, but the approach has not been studied in CCHS and hyperventilation causes cerebral vasoconstriction [7]. Pressure-controlled ventilation ensures adequate ventilation at all ages with uncuffed tubes or a mask; pressure support ventilation with a back-up rate, minimum inspiratory time and guaranteed volume has proved effective above 4 years of age; pressure support modes without a back-up rate and continuous positive airway pressure (CPAP) should be avoided, because they produce a variable breathing pattern [7]. Home ventilators should be certified for the patient’s age and weight, with visual and audible alarms and a battery life of several hours; not all bilevel pressure devices meet these requirements [7].

The French PNDS states the same rules in operational terms: there is no pharmacological treatment for respiratory failure; ventilation is systematic and lifelong during sleep, all night and every night, and in infants and young children also during naps; adherence must be 100%, at the risk of sudden death or severe neurological injury; ventilation is needed in any situation of reduced alertness (fatigue, fever, postprandial drowsiness, loss of consciousness, acute alcohol intoxication); and the ventilator must impose the rate and tidal volume, because the patient does not trigger the cycles [9]. Mechanical ventilation and phrenic nerve pacing may be combined, for example with a ventilator at night and phrenic pacing during wakefulness, and the patency of the upper airway or the tracheostomy is monitored regularly [9].

7.9. CCHS: ventilation modalities

GeneReviews does not recommend diaphragm pacing in young children ventilated only at night, because the benefit does not outweigh the risks, and considers it appropriate in ambulatory children on continuous ventilation and in adolescents and young adults; the electrodes are implanted on each phrenic nerve in the thorax, preferably thoracoscopically, by experienced teams [8]. Decannulation is not assured with pacing during sleep, especially in young children, because of airway obstruction [8, 118]. The first hospital evaluation is performed 6 months after implantation and annually thereafter, with 24-hour monitoring of SpO2 and PCO2; spare antennas and transmitters should be available at home, because unilateral failure results mainly from an antenna defect [7]. Transition to a mask or pacing is prepared by reducing the tube size, tracheoscopy and a sleep study with the tracheostomy capped [7]. In France, the conditions of use and reimbursement of diaphragmatic stimulation were set by a ministerial order of 23 February 2010, which added to the list of reimbursable products an intradiaphragmatic phrenic stimulator, with electrodes implanted in the diaphragm itself and not on the thoracic phrenic nerve [9].

7.10. CCHS: cardiovascular, gastrointestinal, ocular, endocrine and neurological management

Sinus pauses of 3 seconds or more, asymptomatic or with syncope or staring episodes, may justify a cardiac pacemaker [8, 67]. The European guideline recommends following the guidelines of the American College of Cardiology, the American Heart Association and the Heart Rhythm Society: symptomatic patients with recurrent syncope and R-R intervals of 3 seconds or more should have a pacemaker; in asymptomatic patients with R-R of 3 seconds or more, the decision is individual and takes into account age and the frequency and duration of the pauses, a pacemaker being reasonable in an infant and observation with regular Holter monitoring or an implantable loop recorder in a 20/25 young adult with a maximum pause of 3.1 seconds [7]. A dual-chamber pacemaker (DDD) is preferable to an atrial-only pacemaker (AAI) to cover future atrioventricular block and vasovagal syncope, and the lead should be bipolar to avoid interference with phrenic pacing [7]. In the presence of syncope, seizures, breath-holding spells, hypoglycaemia and postural hypotension are excluded; if no cause is found, the Holter recording is prolonged or repeated every 3 to 6 months or a loop recorder is implanted [7].

HSCR, oesophageal dysmotility and severe constipation are treated in the standard way [8]. The European guideline recommends investigating HSCR in any patient with suggestive symptoms, at any age, but not systematically in asymptomatic patients; suction rectal biopsy is the gold standard, anorectal manometry is highly sensitive and contrast enema is the least sensitive and specific method, especially in the first weeks [7]. GeneReviews includes HSCR evaluation in the protocol for genotypes 20/26 onwards and for NPARM, with suction biopsy in the neonatal period or full-thickness biopsy later depending on symptoms and genotype, and ATS 2010 recommended contrast enema or manometry and full-thickness rectal biopsy if constipation was present [8, 86]. Gastro-oesophageal reflux is treated with H2 receptor antagonists or proton pump inhibitors and, if refractory, with antireflux surgery, with speech therapy support [7].

Protective glasses may be needed in bright light and with screens, and medical staff should know the patient’s own pupillary response, because medicines and drugs alter it; pupillometry documents this “signature” at each evaluation [8]. A complete ophthalmological examination is performed at diagnosis and annually thereafter, with correction of refractive errors, retraining of binocular disorders and strabismus and ptosis surgery when needed [7]. Hypoglycaemia due to hyperinsulinism, if seizures have occurred, requires dietary adjustments with or without diazoxide [7]. The ventilatory response to hypercapnia appeared to improve with the oral contraceptive desogestrel in two young women with 20/25 and 20/26, but later studies did not confirm this, and desogestrel is not a treatment for CCHS [8, 119]. In the USA, typical recommendations include early intervention from 0 to 3 years (occupational therapy, physiotherapy, speech and feeding therapy, infant mental health, special education), preschool with an individualised education plan from 3 to 5 years and follow-up by a developmental paediatrician at all ages [8]. Mainstream schooling is possible, with information for educators and annual reassessment of educational needs [7].

The French PNDS adds measures that the other sources do not detail. Orthostatic hypotension may be treated with compression stockings, sodium chloride supplementation and peripheral alpha-adrenergic sympathomimetics; the PNDS gives no doses [9]. The alpha sympathomimetic with an indication in symptomatic orthostatic hypotension is midodrine, whose FDA label, for adults, recommends 10 mg orally 3 times a day during daytime hours, about 4 hours apart (minimum interval 3 hours), with the last dose no later than 18:00 and never less than 4 hours before bedtime; daily doses above 30 mg have no established safety, supine hypertension (systolic pressure above 200 mmHg) is the adverse effect that limits use, and safety and efficacy in children are not established [120]. Use in CCHS is an extrapolation from orthostatic hypotension of other causes and requires monitoring of nocturnal blood pressure, already raised in many patients [7, 120]. The cardiac pacemaker chosen should be a device compatible with a possible phrenic stimulator [9]. In the ENT and maxillofacial sphere, tracheostomised patients should have access to treatment of tracheal granulomas, mask-ventilated patients to medical (local vasoconstrictors, topical corticosteroids) and surgical (adenoidectomy, tonsillectomy, turbinectomy) treatment of nasal obstruction, and maxillofacial growth should be monitored in patients on non-invasive ventilation, with regular dental hygiene and care [9]. In ophthalmology, the PNDS provides for orthoptic retraining, refractive correction and treatment of strabismus that is mainly medical in the first years, surgery being exceptional, whereas the European guideline allows it when needed [7, 9]. In neurology, neuropsychological rehabilitation should be early (speech therapy, psychomotor therapy, sensory integration, specialised education programme), seizures secondary to hypoxaemia or hypoglycaemia require treatment of the cause and, if necessary, antiepileptic drugs, and psychological or psychiatric support extends to family members [9]. In endocrinology, the PNDS provides for growth hormone in the event of deficiency, diet and, if necessary, drugs for glycaemic abnormalities, treatment of thyroid dysfunction and hyperprolactinaemia and contraception follow-up [9]. The somatropin dose in paediatric growth hormone deficiency in the FDA label for Genotropin® is 0.16–0.24 mg/kg/week subcutaneously, divided into 6 or 7 injections; there is no CCHS-specific dose, and deficiency is confirmed by the usual endocrine criteria [121]. Neuroendocrine tumours are treated in collaboration with oncology, surgery and radiology [9].

7.11. CCHS: daily life and accident prevention

Home equipment includes a portable ventilator, a second back-up ventilator, a suction device, an oximeter, a manual resuscitation bag, tubes and spare material, and a PCO2 monitor helps detect hypercapnia and inadvertent hyperventilation; oxygen may be kept available for emergencies [7]. At least two trained carers, an equipment maintenance contract, 24-hour telephone access to a reference centre, an attending physician and a specialist nurse are needed [7]. Moderate sport is encouraged with frequent breaks, because the patient does not increase ventilation with exertion; strenuous activity is risky, especially at the end of exercise [7]. Swimming should only be allowed under close supervision and with limited immersion time, because the patient does not feel the dyspnoea of hypoxia, may lose consciousness and drown; GeneReviews ideally advises against swimming, and underwater swimming and voluntary breath-holding competitions should always be avoided [7, 8]. Air travel is possible, but the cabin is equivalent to an altitude of about 2700 m (oxygen fraction of about 15% at sea level): a ventilator should be available in the cabin if SpO2 falls below 90%, oxygen is added with caution and pre-flight hypoxia testing is discussed in advance [7].

The French PNDS defines the minimum equipment: a life-support ventilator with internal and external batteries and audible alarms, two ventilators per patient under the highest level of home provision (reserved for patients with respiratory autonomy of less than 8 hours or at vital risk if ventilation stops), an oximeter with alarms and memory, a portable oximeter and emergency equipment; the patient should have a ventilation device with them wherever they are [9]. Therapeutic education includes self-monitoring of SpO2 by oximetry during physical activity or, alternatively, identification on an exercise test of the heart rate at which the patient desaturates, subsequently monitored with a heart rate monitor; it also includes avoidance of alcohol, drugs and tobacco [9]. The usual vaccines are not contraindicated; the PNDS recommends annual influenza vaccination, extended to the whole family, pneumococcal vaccination and palivizumab (Synagis®) in the first two years of life [9]. The dose in the European SmPC for palivizumab, in children under 2 years, is 15 mg/kg intramuscularly once a month during the respiratory syncytial virus (RSV) season, with the first dose before the start of the season; the SmPC sets no maximum other than the dose per kilogram and states that the efficacy of other doses or intervals has not been established; the authorised indications cover preterm infants, bronchopulmonary dysplasia and haemodynamically significant heart disease, so use in CCHS follows the PNDS recommendation outside the SmPC indications [122]. Nirsevimab (Beyfortus®), authorised in the EU on 31 October 2022, postdates the PNDS: the SmPC provides for a single intramuscular dose of 50 mg below 5 kg or 100 mg from 5 kg in the first season and, since the extension of 1 August 2024, 200 mg (2 × 100 mg) in the second season in children up to 24 months who remain vulnerable to severe RSV disease, in accordance with each country’s official recommendations [123]. Clesrovimab (Enflonsia®), as a single fixed dose of 105 mg IM, was approved by the FDA on 9 June 2025 and authorised in the EU on 15 April 2026, for the first season only [124, 125]. Neither antibody has a specific indication in CCHS; extending the PNDS recommendation to these drugs is an extrapolation. Integration into nursery and school takes place early and progressively, with an individualised reception plan reviewed every year and, following the institution’s opinion, a ventilator ready for use on site [9]. Physical activities are encouraged in childhood, with possible partial exemption from school sport and a certificate of fitness issued by the hospital reference physician; stays and sports at altitude are only recommended below 1500 m, and breath-hold swimming and scuba diving are prohibited [9]. Flights are prepared with the airline and the reference physicians, with a ventilator, batteries, oximeter and equipment in the cabin, medical certificates for the airlines, customs and border police and, abroad, checking of electrical compatibility and provision for power cuts [9]. Medicines and drugs that reduce alertness are prohibited, and driving is possible once visual abnormalities have been corrected [9].

7.12. Agents to avoid, anaesthesia and the perioperative setting

In CCHS, prescribed or non-prescribed medicines, sedatives and anaesthetics that depress respiration should be avoided, and the same applies to alcohol and recreational drugs [8]. Commonly used medicines, such as antitussives, analgesics and hypnotics, may contain sedative agents or opioids that depress ventilation even during wakefulness [7]. Anaesthesia requires direct supervision by anaesthesiology, assisted ventilation and monitoring of blood gases, blood pressure and blood glucose before, during and after the procedure; short-acting agents, volatile anaesthetics such as sevoflurane or regional anaesthesia are preferred; propofol is used safely in short procedures and for induction, although heart block after a propofol bolus has been described in a child; ventilation and non-invasive gas monitoring should be maintained pre- and postoperatively even with the patient awake, especially with opioid analgesia [7]. After sedation or anaesthesia, ventilation may be needed even during wakefulness, and a patient ventilated only at night may need ventilation 24 hours a day during an acute illness [7]. Cancer treatment of a patient with CCHS, including surgery and chemotherapy, should be planned with the ventilation team [94]. The French PNDS allows general or locoregional anaesthesia only in a hospital setting with a recovery room, intermediate care unit or intensive care, with the anaesthetist informed before the procedure, enhanced monitoring from premedication until complete and definitive awakening, and ventilation ensured throughout the procedure [9]. The respiratory depressant effects of opioids and hypnotics may last longer than in a healthy individual, so agents with short action and a short half-life are preferred; emergence takes place under full assisted ventilation, which in patients who are autonomous during wakefulness is withdrawn only after full and stable return of alertness has been confirmed, with no risk of anaesthetic recirculation, and the patient usually remains in hospital at least the following night [9]. Locoregional anaesthesia does not in theory raise specific problems, but drowsiness during a prolonged procedure may be accompanied by hypoventilation and requires the same monitoring [9]. In ALK carriers without CCHS, there are no agents to avoid because of the germline variant [3]. Lorlatinib is contraindicated with strong CYP3A inducers, and with crizotinib strong CYP3A inhibitors and inducers and narrow-therapeutic-index CYP3A substrates should be avoided [98, 99].

7.13. Pregnancy and lactation

Pregnancy in a woman with CCHS has not been evaluated prospectively and requires careful consideration of ventilatory needs by the obstetrician [8]. The European guideline recommends planning pregnancy only after genetic counselling, and states that pregnant women with CCHS often need more ventilatory support during pregnancy, labour and delivery, because of increased abdominal pressure, and that, after caesarean section, phrenic pacing is painful and should be replaced by mask ventilation for a few days [7]. Delivery of a fetus with a known variant should take place in a centre with high-risk obstetrics and a neonatal team present, capable of immediate intubation and ventilation, in collaboration with a CCHS reference centre [7, 8]. The French PNDS asks that the pregnancy plan be prepared with the reference physician and the geneticist, with joint follow-up by respiratory medicine, obstetrics and anaesthesia in a hospital with obstetrics, neonatology and intensive care; the quality of maternal ventilation is assessed at least once a month, ideally by polysomnography and more often by capnography with nocturnal and daytime home oximetry [9]. As labour involves physical effort and mobilisation of cognitive resources, the woman’s SpO2 is monitored throughout labour and delivery, with assisted ventilation in the event of desaturation; caesarean section follows the anaesthesia rules, and the newborn is examined by the paediatric team and transferred to neonatology [9]. Lorlatinib, crizotinib and eflornithine may cause fetal harm; the labels advise against breastfeeding during lorlatinib and for 7 days after the last dose, during crizotinib, and during eflornithine and for the following week, with effective contraception in women of childbearing potential treated with eflornithine during treatment and for the following week [98, 99, 107].

7.14. Transition to adulthood

Adolescence is the period of highest risk of avoidable death in CCHS: alcohol and drugs have been lethal in unsupervised ventilator-dependent adolescents and young adults, and parents and patients should be warned of the risk of coma and death [7, 8]. Independence is encouraged, but young adults may not hear ventilator alarms during sleep; the solutions described range from staying with the family to living with a trained partner, in a community, with a night-time carer or with dogs trained to respond to alarms [7]. Because of the rarity of CCHS in adults, the European guideline recommends that adults be followed in collaboration with a reference centre [7]. In ALK carriers, surveillance ends at age 10 years, and transition consists mainly of reproductive counselling of the young adult carrier [2, 3].

7.15. Tumour risk management strategies and divergences between guidelines

Tumour risk management is based on imaging and biochemical surveillance from the diagnosis of predisposition until age 10 years, because NB may be present at birth and 98% of tumours arise by that age [2]. The general AACR 2024 protocol is abdominal ultrasound and urinary VMA and HVA every 3 months and chest radiography every 6 months from 0 to 6 years, and abdominal ultrasound and VMA and HVA every 6 months and chest radiography every 6 to 12 months from 6 to 10 years, with no screening after age 10 years; it applies to ALK, PHOX2B (all NPARM and long PARM of 28 to 33 or more repeats), CDKN1C, HRAS, EZH2, 2p24 duplication, ROHHAD and to families or patients with bilateral or multifocal NB without an identified cause [2]. The detailed protocol and the sources for each interval are in the surveillance table in section 11.

The guidelines diverge on four points. The first is the PHOX2B threshold: AACR 2024 recommends surveillance in NPARM and in PARM with more than 28 repeats in the text and with 28 to 33 or more in Table 1, whereas AACR 2017 placed the risk in PARM of 30 to 33 repeats [2, 16]. The second is CDKN1C-related BWS: AACR 2024 applies the standard NB protocol, whereas the 2018 international consensus recommends abdominal ultrasound every 3 months until age 7 years and advises against catecholamine screening (strength of recommendation A+++), because there is no evidence of benefit and because of the minimal effect of population urinary screening [2, 10]. The third is Costello syndrome: AACR 2024 includes it in the general protocol but prohibits urinary screening, and the RASopathy update recommends abdominopelvic ultrasound every 6 to 12 months until age 10 years, without catecholamines and without routine chest radiography, given the absolute risk of thoracic NB below 1%; AACR 2017 accepted catecholamines with a high threshold for investigation [2, 11, 16]. The fourth is CCHS: the 2020 European guideline proposes, in PARM 20/28 to 20/33 and in NPARM, chest and abdominal imaging every 6 months until age 2 years, annually or every two years from 2 to 7 years and according to local oncology protocols after 7, whereas AACR 2024 applies the 3-monthly protocol with catecholamines until age 6 years and 6-monthly until age 10 [2, 7]. The 2018 French PNDS, in the same genotypes (NPARM and PARM from 20/28 onwards), is the least intensive scheme: whole-body MRI, or abdominopelvic ultrasound with chest radiography, once a year until age 3 years and every 2 to 3 years from 3 to 18 years, without catecholamines [9]. AACR 2024 also withdrew NB surveillance for TP53 p.(Arg337His), which AACR 2017 recommended, because of an estimated risk below 1% [2, 16]. There are no prospective trials on the impact of surveillance, and ClinGen assigns limited actionability to ALK predisposition [2, 40].

The 2018 French PNDS is based mainly on the 2010 ATS statement and predates the 2020 European guideline; the following table brings together the points on which it diverges from the other CCHS sources.

[2, 7–9, 18, 86]

For follow-up intervals, the reference is the 2020 European guideline, the most recent and the one that integrates the evidence subsequent to the ATS statement; the PNDS adds examinations and intervals with no equivalent in other sources (annual laboratory tests with iron, IGF-1 and prolactin, annual ambulatory blood pressure monitoring, admission for global evaluation), which are included in the surveillance table in section 11 [7, 9].

8. Reproductive Options and Family Counselling

8.1. ALK: inheritance and recurrence risks

ALK-NTS is transmitted in an autosomal dominant manner. Some probands inherit the variant from a heterozygous parent who may never have had a tumour, because of reduced penetrance, and de novo variants have been described, in an unknown proportion [3, 23, 25]. When a variant appears to be de novo, both parents are tested; if neither is a carrier, with confirmed parentage, the variant is de novo or there is parental germline mosaicism, or somatic and germline mosaicism, which leukocytes may not reveal [3]. Siblings of a proband with a carrier parent have a 50% probability of inheriting the variant and, if they inherit it, about a 50% probability of developing a neuroblastic tumour; if the variant is not detected in the parents’ leukocytes, the recurrence risk for siblings is about 1% because of germline mosaicism; if the parents’ status is unknown, siblings remain at increased risk [3]. Each child of a carrier has a 50% probability of inheriting the variant and, in that case, about a 50% probability of a tumour [3]. Predictive testing identifies carriers but does not predict who will develop a tumour [3].

8.2. PHOX2B and CCHS: inheritance, mosaicism and recurrence

CCHS is typically autosomal dominant, and most patients have a de novo variant [8]. Somatic or germline mosaicism in about 5–25% of asymptomatic parents and the rarer pure germline mosaicism make it mandatory to test both parents with methods able to detect low-level mosaicism [8, 50, 51]. The following table summarises the risks for siblings and children.

[7, 8, 52, 53]

The recurrence risk can only be defined in families with an identified PHOX2B variant [7]. The stability of the repeat on transmission means that the child of a carrier inherits the same expansion length, without anticipation [8]. The offspring of four women with idiopathic CCHS included a child with CCHS, one with recurrent apparent life-threatening events, a preterm infant with chronic lung disease and a reduced response to CO2, and a healthy child at 25 months, which illustrates maternal transmission of altered respiratory control [18]. Identification of carriers among parents, siblings and children allows early treatment, surveillance and prevention, including avoidance of sedatives and anaesthetics without monitoring [8]. The French PNDS recommends always offering testing of the parents: absence of the variant confirms its de novo nature, presence of the variant or of somatic mosaicism in a parent raises the recurrence risk to close to 50%, and the residual risk attributable to germline mosaicism, below 10%, should be explained and may justify prenatal diagnosis in subsequent pregnancies; as the risk of transmission from a patient to their offspring is around 50%, counselling should precede the plan to have children [9].

8.3. Other entities

In the 2p24.3 microduplication and in CDKN1C, HRAS and EZH2 variants, inheritance is autosomal dominant, and the recurrence risk depends on whether the alteration is inherited or de novo; the MYCN variants of MPAPA were de novo in the three patients described [2, 12, 32]. In BWS, the recurrence risk is below 1% in most families, but depends on the 11p15 mechanism [3, 10]. In the recessive forms of CCHS due to MYO1H and LBX1, the risk for siblings is 25% [30, 31]. In ROHHAD there is no identified gene, and there are no data on familial recurrence in the sources consulted [8, 13].

8.4. Cascade testing and testing of minors

When a germline variant is identified in a patient with NB, cascade testing begins with the parents [2]. In ALK carriers, siblings under 10 years of age at the time of the proband’s diagnosis and siblings born afterwards should be tested, because early detection probably improves quality of life and may influence outcome if treatment begins before there is organ damage [3]. As NB may be present at birth, AACR 2024 recommends presymptomatic genetic testing as early as possible in the at-risk infant, and the start of surveillance as soon as the variant is identified [2]. Testing of minors is therefore justified by the direct medical benefit in childhood; after age 10 years, when surveillance is no longer indicated, testing an asymptomatic minor has only future reproductive value, and the decision may be deferred until the person can take part in it. In CCHS, identification of a carrier sibling before any anaesthesia or severe intercurrent illness has direct preventive value [7, 8].

8.5. Prenatal and preimplantation diagnosis and delivery planning

The risk and reproductive options should be discussed before pregnancy with affected young adults, carriers or those at risk [3]. Once the variant has been identified, prenatal diagnosis and PGT are possible, and views on their use differ between professionals and families, especially for a predisposition with a penetrance of about 50% and available surveillance [3]. In CCHS, the European guideline advises prenatal diagnosis in all families with an affected child, even if it is not used to decide on continuation of the pregnancy, because it allows delivery to be planned in a centre able to initiate immediate ventilation [7, 8]. A woman with CCHS who is planning a pregnancy should be informed of the 50% risk of transmission and of the options of prenatal diagnosis and PGT [7]. When one of the parents has CCHS, the French PNDS describes chorionic villus sampling between 12 and 14 weeks of gestation and amniocentesis after 14 weeks, with a risk of fetal loss estimated at 1%; in the case of an affected fetus, termination of pregnancy for medical reasons is possible and, if the parents decide to continue, a neonatal resuscitator should be present at delivery to initiate immediate ventilation [9].

8.6. Content of counselling

Counselling should address the difference between the risk of inheriting the variant and the risk of having a tumour, the time-limited nature of the tumour risk (highest in infancy, decreasing until age 10 years), the fact that surveillance also identifies maturing or regressing tumours that would have had no clinical significance, the absence of prospective evidence on the impact of surveillance and, in ALK carriers, the absence of an established risk of other tumours [2, 3]. In CCHS, it adds the lifelong nature of ventilatory dependence, the cardiac risk, the tumour risk specific to the genotype and the dangers of sedation, alcohol and water [7, 8]. The French PNDS asks that the diagnosis be communicated in a private setting, with time, preferably with both parents, by the prescriber of the molecular test together with an expert in the disease and, if necessary, a psychologist, genetic counsellor or nurse; the consultation includes explanation of the results, of transmission to current and future siblings, of complications and of treatment, drawing up the care plan, consents for genotyping, for inclusion in the national and international registries and for the national biological collection, and information about patient associations [9]. Genetic counselling may begin at the time of disclosure, but the PNDS suggests, especially when the patient is a child, a later dedicated appointment with the parents and without the child, and recommends psychological support at disclosure and throughout follow-up [9].

9. Special Considerations: Population Diversity and Epidemiology

9.1. Neuroblastoma: what each figure measures

[1, 2, 16]

The Orphanet values measure different quantities: annual incidence refers to new cases per year in the population, birth prevalence to the number of cases per births, and point prevalence to living patients at a given time [1]. The German figure of 14/100,000 should be read in the context of urinary screening of infants, which increased the detection of tumours that would have regressed spontaneously [1, 14]. The proportions of hereditary NB come from hospital series and not from population studies [2]. The population frequency of germline ALK carriers is unknown: ClinVar, dominated by somatic submissions, does not allow it to be estimated, and in the Michigan study none of the carriers reported among 1948 children with early tumours had an ALK variant, compared with one PHOX2B variant [40, 81]. Table 1 of that study attributes ALK to 1–2% and PHOX2B to 0.1% of NB, citing another source, and among 1498 internal controls without NB one PHOX2B carrier was found [81].

9.2. CCHS: incidence and prevalence

The French incidence comes from the national registry published in Chest in 2005 and not from the heart rate variability study published in the same year, to which GeneReviews attributes it [5, 8]. Applied to worldwide births since 1970, the incidences from France and Japan predict 33,000 to 45,000 diagnosed patients, compared with about 3000 identified, which means that many patients died without a diagnosis or have very mild forms, or that the estimates do not apply worldwide [8]. In 1999, the ATS statement estimated 160 to 180 children living with CCHS worldwide, a figure the authors themselves considered an underestimate and which the introduction of PHOX2B testing has surpassed [18]. The sources consulted do not include CCHS incidence estimates for Portugal, Brazil or the USA.

9.3. Geography, ancestry and founder effects

The series underpinning the genetics of familial NB come from the USA, France, Japan, Sweden and the United Kingdom [12, 23, 25, 26, 28, 48]. The sources consulted do not describe founder variants of ALK or PHOX2B. The TP53 variant p.(Arg337His), known as the “Brazilian variant”, is the main Brazilian datum in the sources consulted: NB has been described in carriers (Seidinger 2015), but the estimated prevalence is below 1%, and AACR 2024 does not recommend NB surveillance in these carriers [2, 16]. In the Japanese series of 92 patients with CCHS, the 20/25 patients had a male predominance of about 3:1, which suggests a sex-linked modifying factor in the reduced-penetrance alleles [6, 18]. In the Cincinnati series of 20 patients with CCHS, four of the six with cardiac anomalies were African American, a descriptive finding without a denominator by ancestry [18]. HSCR associated with CCHS is modulated by the RET haplotype predisposing to non-syndromic HSCR [18]. The sources consulted do not include data from Portugal on familial NB or CCHS, which does not demonstrate their absence; the 7th CCHS Global Research Conference takes place from 20 to 23 October 2026 near Lisbon [128].

9.4. Special populations

Preterm infants with apnoeas that do not respond to caffeine and exceed what is expected for immaturity merit evaluation for hypoventilation, because CCHS and hypoventilation due to an ALK variant have been described in preterm infants [8, 48]. Adults with unexplained hypoventilation, failure to wean or hypoventilation triggered by sedation may have LO-CCHS or be mosaic parents of an affected child [7, 18]. In pregnant women with CCHS, ventilatory requirements increase over the course of pregnancy [7]. In patients with obesity, as in ROHHAD, ultrasound may be technically limited, and MRI may replace it or alternate with it [2]. Children with Costello syndrome have raised and variable baseline urinary catecholamines, which invalidates the biochemical marker [11].

9.5. European reference networks and patient associations

ERN PaedCan (paediatric cancer) and ERN GENTURIS (genetic tumour risk syndromes) are the European reference networks relevant to hereditary NB [129, 130]. ERNICA, the network for inherited and congenital digestive anomalies, officially covers Hirschsprung disease and is relevant to the gastrointestinal component of Haddad syndrome, but CCHS is not among its areas; Orphanet lists no ERN for CCHS, only eight national or regional networks for broader groups of diseases (Canada, Finland, France, Germany, Spain and the United Kingdom) [131, 132]. The sources consulted do not confirm the inclusion of CCHS within the scope of ERN-LUNG [133]. ERN-ITHACA is the network for malformation syndromes, relevant to the RASopathies and BWS [134]. SIOPEN coordinates European NB trials [135].

Orphanet lists no CCHS patient association in Portugal or Spain [132]. The European CCHS consortium maintains a registry and patient leaflets in several languages, including Portuguese, linked from the Orphanet entry [132]. The international CCHS and ROHHAD registries are listed on ClinicalTrials.gov, and the Center for Autonomic Medicine in Pediatrics at Lurie Children's Hospital, in Chicago, is the North American reference centre described in GeneReviews [8]. In France, the PNDS organises care at four levels: the reference centres (rare respiratory diseases of children at Robert Debré Hospital and rare lung diseases of adults at Pitié-Salpêtrière Hospital, both in Paris), seven competence centres (Bordeaux, Dijon, Lille, Lyon, Montpellier, Nantes and Strasbourg) or the regional hospital, the local network that makes home visits (family doctor or paediatrician, ventilation technicians, physiotherapists) and the expert family, at the centre of the system; coordination is the responsibility of a hospital physician, usually an intensivist or respiratory physician, in liaison with the reference centre and the family doctor [9]. The PNDS serves as the basis for the care protocol for exemption from patient co-payment for a condition outside the list of long-term illnesses, and the social worker supports families in accessing disability benefits; the document also refers to the website of the French reference centre (ondinefrance.org), to the European CCHS group (EUCHS) and to AFSOndine [9].

10. Illustrative Clinical Case

10.1. Multifocal neuroblastoma and central hypoventilation in a female infant with a de novo germline ALK variant

Djos and colleagues, from the Karolinska Institute and Gothenburg, described in 2022 a preterm female newborn of 32 weeks and 4 days, weighing 1890 g, delivered by caesarean section for impending fetal asphyxia, who required 3 minutes of mask ventilation and then continuous positive airway pressure [48]. Shortly after birth a diaphragmatic hernia was suspected and repaired at a tertiary centre. In the neonatal intensive care unit, the infant had frequent apnoeas and desaturations that did not respond to caffeine citrate and exceeded what was expected for the immaturity of respiratory control, and infrequent stools [48]. Paucity of lower limb movements and atrophy of the gluteal muscles led to MRI, which showed multiple lobulated masses in the abdomen and thorax, suggestive of NB, with bilateral thoracic tumours and a large retroperitoneal mass (Figure 1A and 1B of the article, consulted at https://pmc.ncbi.nlm.nih.gov/articles/PMC9498070/figure/diagnostics-12-02260-f001/) [48]. As intraspinal invasion could be neither confirmed nor excluded, the team started etoposide, carboplatin and betamethasone before histology, and the authors state that no effective ALK inhibitor was then available for the patient; the biopsy, two days later, showed ganglioneuroblastoma (Figure 1C) [48].

At diagnosis, the urinary metabolites were partially raised: dopamine/creatinine 1790 nmol/mmol, HVA/creatinine 189 µmol/mmol (reference below 20) and VMA/creatinine 300 [48]. The infant had clinical seizures without an electroencephalographic correlate, with interictal epileptiform activity, treated with midazolam and phenobarbital [48]. Six weeks after the first cycle, tumour volume had decreased, but apnoeas and hypoventilation persisted, with almost constant hypercapnia and the need for periods of continuous positive airway pressure and ventilation; cardiorespiratory polygraphy excluded seizures as the cause of hypoventilation [48]. At 3 months, 2 months after diagnosis, she died of respiratory failure after worsening desaturations and bradycardia, probably triggered by infection [48]. The tumour was classified as stage L2 of the INRG staging system (INRGSS), with diagnosis at 4 weeks and INRG low-risk group; the thoracic sample was an undifferentiated NB with a purely numerical profile and the two abdominal samples were GNB, one of them with segmental aberrations (1p and 4q deletion, 2p and 13q gain), without MYCN amplification or 11q deletion [48]. At autopsy, the abdominal tumour originated in the right adrenal gland, with abdominal lymph node and microscopic hepatic metastases; the central nervous system, including brainstem morphology, was normal, and the small bowel and colon had normal ganglia, which excluded HSCR (Figure 1G and 1H) [48].

Genetic testing found no PHOX2B variants by sequencing of exons 1 to 3 or by genome sequencing, including introns and promoter, nor in ASCL1, MYO1H, LBX1, RET, GDNF, SOX10, EDNRB, EDN3 and other genes of the pathway [48]. The ALK variant NM_004304.5:c.3520T>A p.(Phe1174Ile) (described in the article on NM_004304.4) was found in heterozygosity, present in the three tumour samples, in the patient’s blood and central nervous system tissue and absent in both parents, consistent with a de novo variant barring undetectable parental mosaicism; digestion with the ApoI enzyme confirmed the result, and the 2p gain in sample 3, which included ALKAL2, MYCN and ALK, raised the ALK allele fraction to 70% (Figure 2A–2D, consulted at https://pmc.ncbi.nlm.nih.gov/articles/PMC9498070/figure/diagnostics-12-02260-f002/) [41, 48]. Tumour genome sequencing revealed only two non-synonymous somatic alterations, in CEP170 and HIVEP2, and the authors interpreted these “silent” genomes as an indication that oncogenic ALK may be sufficient for early NB [48].

The case illustrates three points of this article. The first is that central hypoventilation in a newborn with multifocal NB is not exclusive to PHOX2B, and the authors recommend sequencing the ALK hotspots in newborns with NB and hypoventilation without a PHOX2B variant, as in the two patients of de Pontual with de novo p.(Phe1174Val) and p.(Phe1245Val) [47, 48]. The second is that the tumour allele fraction does not by itself distinguish a germline from a somatic variant when there is a 2p gain [48]. The third is that the INRG low-risk group did not reflect the severity, which was determined by respiratory failure and not by tumour biology. Chemotherapy without prior histology, prompted by the risk of spinal cord compression, and the absence of an ALK inhibitor were decisions specific to the context and period of the case; today, a relapsed or refractory NB with altered ALK may be treated with lorlatinib in a trial or off-label, and ANBL1531 is evaluating first-line lorlatinib in high-risk disease [83, 115].

10.2. A family with PHOX2B without hypoventilation

Trochet and colleagues described in 2004 a family in which the proband had a multifocal abdominal GN removed at age 10 years, the younger brother an abdominal NB at age 6 years, removed surgically, with local recurrences at 18 and 30 months, and the father a GN of the adrenal medulla removed at age 44 years; the family carried the PHOX2B variant p.(Arg100Leu), NM_003924.4:c.299G>T [4, 21, 41]. In the same publication, an unrelated patient with HSCR operated on in the neonatal period had multifocal thoracic and abdominal NB at 9 months, without recurrence at 10 years, with the p.(Arg141Gly) variant inherited from his unaffected mother [4, 21]. The family shows incomplete penetrance, the coexistence of mature and immature tumours in the same family and the diagnosis of GN in adulthood, which underpin systematic enquiry about benign tumours in relatives [3, 4].

11. Prognosis and Long-Term Follow-Up

11.1. Prognosis of the neuroblastic tumour in the carrier

The most important prognostic factor in NB is the extent of the tumour at diagnosis, together with age and tumour biology [3, 14]. In germline carriers, survival probably depends more on tumour type, stage and treatment than on the variant; long-term survivors exist and no prospective study has compared carriers and non-carriers [3]. In the study of 786 patients with NB, carriers of pathogenic or likely pathogenic variants in cancer predisposition genes, mainly BARD1, had worse overall survival, an effect independent of other predictors, whose clinical application is not yet defined [60]. Among somatic variants, ALK activation, p.(Phe1174Leu) with MYCN amplification and ALK amplification are associated with a worse prognosis [3]. Early detection through surveillance should allow treatment before organ damage and metastatic disease, but surveillance also identifies maturing or regressing tumours, and there are no prospective studies of its impact on mortality [2, 3].

11.2. Prognosis of CCHS

In the 2005 French cohort, overall mortality was 38%, with a median age at death of 3 months; with adequate artificial ventilation, many patients live into the third and fourth decades, with the potential for a normal life expectancy [5, 8]. The causes of avoidable death are recurrent hypoxaemia and hypercapnia due to suboptimal ventilatory support or lack of adherence, alcohol and drugs in unsupervised adolescents and young adults, asystoles without a pacemaker, and failure or battery depletion of a pacemaker without sufficient monitoring [8]. The neurocognitive prognosis depends on the quality of oxygenation and ventilation in the first years and on the genotype [7, 70]. In genotypes 20/28 to 20/33 and in NPARM there is an additional tumour risk, with tumour deaths being rare; the exception described is a 20/33 infant with high-risk metastatic NB [8, 94]. According to the French PNDS, severity is measured by the number and severity of associated autonomic failures: long-segment colonic or pancolonic HSCR identifies a very severe form, with high mortality and disability, which in some cases leads to discussion of continuation or limitation of care, and neonatal neurological complications (lesions or intracerebral haemorrhage) are a sign of poor prognosis [9].

11.3. Surveillance table

The table brings together protocols that do not coincide. For ALK carriers and the other predispositions in the general protocol, AACR 2024 is the reference guideline; the ALK GeneReviews reproduces the same scheme [2, 3]. In Costello syndrome the RASopathy update is followed and, in CDKN1C-related BWS, there are two published options, the general AACR 2024 protocol and the 2018 consensus scheme, the choice between which is discussed with the family and with the team following the BWS [2, 10, 11]. In CCHS, the tumour surveillance of the European guideline is less frequent and does not include catecholamines; AACR 2024 applies the general protocol to PHOX2B carriers with NPARM or PARM of 28 or more repeats [2, 7]. The annual 48–72-hour Holter is recommended by the European guideline for all patients, and GeneReviews gives a 72-hour Holter at the frequency of the physiological evaluation [7, 8]. The French PNDS rows reproduce the text and the follow-up appendix of the document, which do not coincide on two points in the first year (ventilation clinic and technician visit); both values are presented, and the appendix itself states that it can be adapted to each case [9]. Oncological surveillance continues after successful treatment of a first tumour, because of the risk of multiple primary tumours [3]. In all cases, the family should know the warning signs described in section 4.4 and have rapid access to the team [2].

11.4. Long-term follow-up and transition

Patients with CCHS are followed throughout life in a reference centre with experience in home ventilation, intensive care and cardiorespiratory recordings with PCO2, that takes part in registries and research; adults should maintain contact with that centre [7]. ALK carriers who have completed surveillance at age 10 years have no recommendation for further screening, and their next appointment is for reproductive counselling [2, 3]. In treated NB survivors, follow-up of the late effects of chemotherapy, radiotherapy, transplantation and immunotherapy follows the programmes of the paediatric oncology centres and does not differ because of the germline variant [3]. In CCHS, the French PNDS assigns to the family doctor the usual follow-up of the child (growth, vaccines), ensuring that specialist follow-up takes place within a team linked to the reference or competence centre, the detection of complications, the diagnosis and treatment of acute events, especially infections, and coordination with social, educational, occupational and psychological support [9].

12. Summary and Concluding Remarks

Germline predisposition accounts for a small fraction of NB, about 1–2% with a family history and a further 3–4% with bilateral or multifocal disease, but has direct consequences for the patient and the family [2]. ALK is the main gene of familial NB, with activating variants in the tyrosine kinase domain, autosomal dominant transmission and a penetrance of about 50%; carriers have no other phenotype, except for the rare highly activating de novo variants that combine congenital NB, encephalopathy, brainstem abnormalities and hypoventilation [3, 47, 48]. PHOX2B links NB to CCHS and HSCR, and the variant type defines the risk: NPARM confer a neural crest tumour risk of about 45–50%, long PARM of 28 to 33 repeats a low risk and short PARM a practically nil risk [2, 8, 16]. The syndromic spectrum with recommended surveillance includes CDKN1C-related BWS, Costello syndrome, Weaver syndrome, the 2p24.3 microduplication involving MYCN and ROHHAD, while TP53 p.(Arg337His), NF1, Noonan syndrome, BARD1, SMARCA4 and KIF1B fall below the 1% threshold or have no estimate [2, 12].

Germline testing is indicated in the presence of a family history of neuroblastic tumour, bilateral or multifocal tumours, a somatic ALK variant in the tumour or syndromic features; for ALK sequencing suffices, but for PHOX2B fragment analysis targeting the repeat is necessary, because next-generation sequencing panels do not detect most expansions, and testing of the parents should look for low-level mosaicism [2, 3, 8]. Carrier surveillance, according to AACR 2024, combines abdominal ultrasound and urinary catecholamines every 3 months until age 6 years and every 6 months until age 10, with less frequent chest radiography, and diverges from schemes specific to Costello syndrome, BWS and CCHS [2, 7, 10, 11]. A carrier’s tumour is treated as in the general population; ALK inhibitors, with lorlatinib as the most studied drug, are used in NB only within a trial or off-label, with paediatric doses defined in trials and pulmonary toxicity when combined with anti-GD2 antibodies [3, 83, 106].

CCHS is a disease of lifelong ventilatory dependence in which no drug replaces ventilation, oxygen alone is dangerous, and sedation, alcohol and water are avoidable risks; the prognosis depends on the quality of ventilation, cardiac monitoring and the education of the family and the patient, and many patients reach adulthood [7, 8]. The sources describe no founder variants of ALK or PHOX2B and include no data from Portugal on these entities, and the main Brazilian datum is TP53 p.(Arg337His), now outside the indications for NB surveillance [2]. The impact of surveillance on mortality and the role of first-line ALK inhibitors remain to be demonstrated in prospective studies, and ANBL1531 and the planned HR-NBL2 amendment are the expected sources of data [115, 117].

13. References

1. Orphanet. Neuroblastoma (ORPHA:635). https://www.orpha.net/en/disease/detail/635
2. Kamihara J, Diller LR, Foulkes WD, Michaeli O, Nakano Y, Pajtler KW, et al. Neuroblastoma predisposition and surveillance — an update from the 2023 AACR Childhood Cancer Predisposition Workshop. Clin Cancer Res. 2024;30(15):3137-43. doi:10.1158/1078-0432.CCR-24-0237.
3. Greengard EG, Perrino MR, Park JR. ALK-Related Neuroblastic Tumor Susceptibility. In: Adam MP, Feldman J, Mirzaa GM, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993–2026. Published 5 Jan 2010; last full update 23 May 2024. NBK24599.
4. OMIM. #613013 Neuroblastoma, susceptibility to, 2; NBLST2 (includes neuroblastoma with Hirschsprung disease). Baltimore: Johns Hopkins University. [https://omim.org/entry/613013](https://omim.org/entry/613013). Accessed 17 Oct 2026.
5. Trang H, Dehan M, Beaufils F, Zaccaria I, Amiel J, Gaultier C; French CCHS Working Group. The French Congenital Central Hypoventilation Syndrome Registry: general data, phenotype, and genotype. Chest. 2005;127(1):72-9. doi:10.1378/chest.127.1.72.
6. Shimokaze T, Sasaki A, Meguro T, Hasegawa H, Hiraku Y, Yoshikawa T, et al. Genotype-phenotype relationship in Japanese patients with congenital central hypoventilation syndrome. J Hum Genet. 2015;60:473-7. PMID:26063465.
7. Trang H, Samuels M, Ceccherini I, Frerick M, Garcia-Teresa MA, Peters J, et al. Guidelines for diagnosis and management of congenital central hypoventilation syndrome. Orphanet J Rare Dis. 2020;15(1):252. doi:10.1186/s13023-020-01460-2.
8. Weese-Mayer DE, Rand CM, Khaytin I, Slattery SM, Yap KL, Marazita ML, Berry-Kravis EM. Congenital Central Hypoventilation Syndrome. In: Adam MP, Feldman J, Mirzaa GM, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993–2026. Published 28 Jan 2004; last full update 28 Jan 2021. NBK1427.
9. Haute Autorité de Santé. Protocole National de Diagnostic et de Soins (PNDS): Syndrome d'Ondine. Centre de référence des maladies respiratoires rares de l'enfant et de l'adulte. Saint-Denis La Plaine: HAS; 21 Feb 2018. https://www.has-sante.fr/jcms/c_2829806
10. Brioude F, Kalish JM, Mussa A, Foster AC, Bliek J, Ferrero GB, et al. Expert consensus document: Clinical and molecular diagnosis, screening and management of Beckwith-Wiedemann syndrome: an international consensus statement. Nat Rev Endocrinol. 2018;14(4):229-49. doi:10.1038/nrendo.2017.166.
11. Perrino MR, Das A, Scollon SR, Mitchell SG, Greer MC, Yohe ME, et al. Update on pediatric cancer surveillance recommendations for patients with neurofibromatosis type 1, Noonan syndrome, CBL syndrome, Costello syndrome, and related RASopathies. Clin Cancer Res. 2024;30(21):4834-43. doi:10.1158/1078-0432.CCR-24-1611.
12. Taylor CA, May P, Stone TJ, Ahmed M, Chowdhury T, Tweddle DA, et al. Germline duplication of MYCN predisposes to childhood embryonal tumours. EBioMedicine. 2026;124:106132. doi:10.1016/j.ebiom.2026.106132.
13. Orphanet. Rapid-onset childhood obesity-hypothalamic dysfunction-hypoventilation-autonomic dysregulation syndrome (ORPHA:293987). https://www.orpha.net/en/disease/detail/293987
14. OMIM. %256700 Neuroblastoma, susceptibility to, 1; NBLST1. Baltimore: Johns Hopkins University. [https://omim.org/entry/256700](https://omim.org/entry/256700). Accessed 17 Oct 2026.
15. Knudson AG Jr, Strong LC. Mutation and cancer: neuroblastoma and pheochromocytoma. Am J Hum Genet. 1972;24(5):514-32. PMID:4340974.
16. Kamihara J, Bourdeaut F, Foulkes WD, Molenaar JJ, Mossé YP, Nakagawara A, et al. Retinoblastoma and neuroblastoma predisposition and surveillance. Clin Cancer Res. 2017;23(13):e98-e106. doi:10.1158/1078-0432.CCR-17-0652.
17. Mellins RB, Balfour HH Jr, Turino GM, Winters RW. Failure of automatic control of ventilation (Ondine's curse). Report of an infant born with this syndrome and review of the literature. Medicine (Baltimore). 1970;49:487-504. PMID:5286083.
18. OMIM. #209880 Central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease; CCHS1. Baltimore: Johns Hopkins University. [https://omim.org/entry/209880](https://omim.org/entry/209880). Accessed 17 Oct 2026.
19. Amiel J, Laudier B, Attié-Bitach T, Trang H, de Pontual L, Gener B, et al. Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome. Nat Genet. 2003;33(4):459-61. doi:10.1038/ng1130.
20. Weese-Mayer DE, Berry-Kravis EM, Zhou L, Maher BS, Silvestri JM, Curran ME, Marazita ML. Idiopathic congenital central hypoventilation syndrome: analysis of genes pertinent to early autonomic nervous system embryologic development and identification of mutations in PHOX2B. Am J Med Genet A. 2003;123A:267-78. PMID:14608649.
21. Trochet D, Bourdeaut F, Janoueix-Lerosey I, Deville A, de Pontual L, Schleiermacher G, et al. Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma. Am J Hum Genet. 2004;74(4):761-4. doi:10.1086/383253.
22. Mosse YP, Laudenslager M, Khazi D, Carlisle AJ, Winter CL, Rappaport E, et al. Germline PHOX2B mutation in hereditary neuroblastoma. Am J Hum Genet. 2004;75(4):727-30. doi:10.1086/424530.
23. Mossé YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, et al. Identification of ALK as a major familial neuroblastoma predisposition gene. Nature. 2008;455(7215):930-5. doi:10.1038/nature07261.
24. OMIM. #613014 Neuroblastoma, susceptibility to, 3; NBLST3. Baltimore: Johns Hopkins University. [https://omim.org/entry/613014](https://omim.org/entry/613014). Accessed 17 Oct 2026.
25. Janoueix-Lerosey I, Lequin D, Brugières L, Ribeiro A, de Pontual L, Combaret V, et al. Somatic and germline activating mutations of the ALK kinase receptor in neuroblastoma. Nature. 2008;455(7215):967-70. doi:10.1038/nature07398.
26. Chen Y, Takita J, Choi YL, Kato M, Ohira M, Sanada M, et al. Oncogenic mutations of ALK kinase in neuroblastoma. Nature. 2008;455(7215):971-4. doi:10.1038/nature07399.
27. George RE, Sanda T, Hanna M, Fröhling S, Luther W 2nd, Zhang J, et al. Activating mutations in ALK provide a therapeutic target in neuroblastoma. Nature. 2008;455(7215):975-8. doi:10.1038/nature07397.
28. Bourdeaut F, Ferrand S, Brugières L, Hilbert M, Ribeiro A, Lacroix L, et al. ALK germline mutations in patients with neuroblastoma: a rare and weakly penetrant syndrome. Eur J Hum Genet. 2012;20(3):291-7. doi:10.1038/ejhg.2011.195.
29. Brodeur GM, Nichols KE, Plon SE, Schiffman JD, Malkin D. Pediatric cancer predisposition and surveillance: an overview, and a tribute to Alfred G. Knudson Jr. Clin Cancer Res. 2017;23(11):e1-e5. doi:10.1158/1078-0432.CCR-17-0702.
30. OMIM. #619482 Central hypoventilation syndrome, congenital, 2, and autonomic dysfunction; CCHS2. Baltimore: Johns Hopkins University. [https://omim.org/entry/619482](https://omim.org/entry/619482). Accessed 17 Oct 2026.
31. OMIM. #619483 Central hypoventilation syndrome, congenital, 3; CCHS3. Baltimore: Johns Hopkins University. [https://omim.org/entry/619483](https://omim.org/entry/619483). Accessed 17 Oct 2026.
32. OMIM. #620748 Megalencephaly-polydactyly syndrome; MPAPA. Baltimore: Johns Hopkins University. [https://omim.org/entry/620748](https://omim.org/entry/620748). Accessed 17 Oct 2026.
33. Orphanet. Haddad syndrome (ORPHA:99803). https://www.orpha.net/en/disease/detail/99803
34. Orphanet. Hirschsprung disease-ganglioneuroblastoma syndrome (ORPHA:2151). https://www.orpha.net/en/disease/detail/2151
35. OMIM. %613015 Neuroblastoma, susceptibility to, 4; NBLST4. Baltimore: Johns Hopkins University. [https://omim.org/entry/613015](https://omim.org/entry/613015). Accessed 17 Oct 2026.
36. OMIM. %613016 Neuroblastoma, susceptibility to, 5; NBLST5. Baltimore: Johns Hopkins University. [https://omim.org/entry/613016](https://omim.org/entry/613016). Accessed 17 Oct 2026.
37. OMIM. %613017 Neuroblastoma, susceptibility to, 6; NBLST6. Baltimore: Johns Hopkins University. [https://omim.org/entry/613017](https://omim.org/entry/613017). Accessed 17 Oct 2026.
38. OMIM. %616792 Neuroblastoma, susceptibility to, 7; NBLST7. Baltimore: Johns Hopkins University. [https://omim.org/entry/616792](https://omim.org/entry/616792). Accessed 17 Oct 2026.
39. Ritenour LE, Randall MP, Bosse KR, Diskin SJ. Genetic susceptibility to neuroblastoma: current knowledge and future directions. Cell Tissue Res. 2018;372:287-307. PMID:29589100.
40. GeneGuidance. ALK gene record (neuroblastoma susceptibility 3) [local curation database]. Accessed 17 Oct 2026.
41. Freeman PJ, Hart RK, Gretton LJ, Brookes AJ, Dalgleish R. VariantValidator: accurate validation, mapping, and formatting of sequence variation descriptions. Hum Mutat. 2018;39(1):61-8. doi:10.1002/humu.23348.
42. National Center for Biotechnology Information. ClinVar. https://www.ncbi.nlm.nih.gov/clinvar/ (VCV000018083, VCV000217849/51/52, VCV000065671, VCV000018085, VCV000018084, VCV000643179, VCV001906146, VCV000012379, VCV000802070, VCV000986849, VCV001323446, VCV000506167, VCV000452239, VCV001323445, VCV000984923, VCV003348471)
43. Pugh TJ, Morozova O, Attiyeh EF, Asgharzadeh S, Wei JS, Auclair D, et al. The genetic landscape of high-risk neuroblastoma. Nat Genet. 2013;45:279-84. PMID:23334666.
44. Bresler SC, Weiser DA, Huwe PJ, Park JH, Krytska K, Ryles H, et al. ALK mutations confer differential oncogenic activation and sensitivity to ALK inhibition therapy in neuroblastoma. Cancer Cell. 2014;26:682-94. PMID:25517749.
45. Kee et al. Genomics in Skin, Neurological and Rare Cancers. In: ESMO Handbook — Cancer Genomics. Lugano: ESMO Press. p. 100–104.
46. Saint-Charles A, Masliah-Planchon J, Saberi-Ansari E, et al. Harmonization of reporting of ALK genetic alterations in neuroblastoma: a SIOPEN Biology Study. J Mol Diagn. 2026. doi:10.1016/j.jmoldx.2025.09.007.
47. de Pontual L, Kettaneh D, Gordon CT, Oufadem M, Boddaert N, Lees M, et al. Germline gain-of-function mutations of ALK disrupt central nervous system development. Hum Mutat. 2011;32(3):272-6. doi:10.1002/humu.21442.
48. Djos A, Treis D, Fransson S, Gordon Murkes L, Wessman S, Ásmundsson J, et al. Multifocal neuroblastoma and central hypoventilation in an infant with germline ALK F1174I mutation. Diagnostics (Basel). 2022;12(9):2260. doi:10.3390/diagnostics12092260.
49. GeneGuidance. PHOX2B gene record (CCHS and neuroblastoma susceptibility 2) [local curation database]. Accessed 17 Oct 2026.
50. Bachetti T, Parodi S, Di Duca M, Santamaria G, Ravazzolo R, Ceccherini I. Low amounts of PHOX2B expanded alleles in asymptomatic parents suggest unsuspected recurrence risk in congenital central hypoventilation syndrome. J Mol Med (Berl). 2011;89:505-13. PMID:21336852.
51. Rand CM, Yu M, Jennings LJ, Panesar K, Berry-Kravis EM, Zhou L, Weese-Mayer DE. Germline mosaicism of PHOX2B mutation accounts for familial recurrence of congenital central hypoventilation syndrome (CCHS). Am J Med Genet A. 2012;158A:2297-301. PMID:22821709.
52. Trochet D, de Pontual L, Estevão MH, Mathieu Y, Munnich A, Feingold J, et al. Homozygous mutation of the PHOX2B gene in congenital central hypoventilation syndrome (Ondine's curse). Hum Mutat. 2008;29(5):770. PMID:18407552.
53. Sivan Y, Zhou A, Jennings LJ, Berry-Kravis EM, Yu M, Zhou L, et al. Congenital central hypoventilation syndrome: severe disease caused by co-occurrence of two PHOX2B variants inherited separately from asymptomatic family members. Am J Med Genet A. 2019;179:503-6. PMID:30672101.
54. Trochet D, O'Brien LM, Gozal D, Trang H, Nordenskjöld A, Laudier B, et al. PHOX2B genotype allows for prediction of tumor risk in congenital central hypoventilation syndrome. Am J Hum Genet. 2005;76:421-6. PMID:15657873.
55. Berry-Kravis EM, Zhou L, Rand CM, Weese-Mayer DE. Congenital central hypoventilation syndrome: PHOX2B mutations and phenotype. Am J Respir Crit Care Med. 2006;174:1139-44. PMID:16888290.
56. Orphanet. Megalencephaly-postaxial polydactyly-ventriculomegaly-neuroblastoma syndrome (ORPHA:730286). https://www.orpha.net/en/disease/detail/730286
57. Nyhan WL, Hoffmann GF, Al-Aqeel AI, Barshop BA. Atlas of Inherited Metabolic Diseases. 4th ed. Boca Raton: CRC Press; 2020. p. 805 (NBAS-RALF deficiency).
58. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 211 (Weaver syndrome).
59. Witkowski L, Nichols KE, Jongmans M, van Engelen N, de Krijger RR, Herrera-Mullar J, et al. Germline pathogenic SMARCA4 variants in neuroblastoma. J Med Genet. 2023;60(10):987-92. doi:10.1136/jmg-2022-108854.
60. Kim J, Vaksman Z, Egolf LE, Kaufman R, Evans JP, Conkrite KL, et al. Germline pathogenic variants in neuroblastoma patients are enriched in BARD1 and predict worse survival. J Natl Cancer Inst. 2024;116(1):149-59. doi:10.1093/jnci/djad183.
61. Schlisio S, Kenchappa RS, Vredeveld LC, George RE, Stewart R, Greulich H, et al. The kinesin KIF1Bbeta acts downstream from EglN3 to induce apoptosis and is a potential 1p36 tumor suppressor. Genes Dev. 2008;22(7):884-93. doi:10.1101/gad.1648608.
62. GeneGuidance. KIF1B gene record (neuroblastoma susceptibility 1) [local curation database]. Accessed 17 Oct 2026.
63. Firth HV, Hurst JA. Oxford Desk Reference: Clinical Genetics and Genomics. 2nd ed. Oxford: Oxford University Press; 2017. p. 584 (Li–Fraumeni syndrome, Table 4.15).
64. Oldridge DA, Wood AC, Weichert-Leahey N, Crimmins I, Sussman R, Winter C, et al. Genetic predisposition to neuroblastoma mediated by a LMO1 super-enhancer polymorphism. Nature. 2015;528(7582):418-21. doi:10.1038/nature15540.
65. ClinGen. Gene-disease validity curations: ALK–neuroblastoma susceptibility 3; PHOX2B–CCHS 1; PHOX2B–Haddad syndrome. https://search.clinicalgenome.org/kb/gene-validity
66. GeneGuidance. LIN28B/neuroblastoma record, with Orphanet HPO phenotype frequencies [local curation database]. Accessed 17 Oct 2026.
67. Gronli JO, Santucci BA, Leurgans SE, Berry-Kravis EM, Weese-Mayer DE. Congenital central hypoventilation syndrome: PHOX2B genotype determines risk for sudden death. Pediatr Pulmonol. 2008;43:77-86. PMID:18041756.
68. Saudubray JM, Baumgartner MR, García-Cazorla Á, Walter J, editors. Inborn Metabolic Diseases: Diagnosis and Treatment. 7th ed. Berlin: Springer; 2022. Chapter 6, Congenital Hyperinsulinism and Genetic Disorders of Insulin Resistance and Signalling, section 6.1 Clinical Presentation.
69. Zelko FA, Nelson MN, Leurgans SE, Berry-Kravis EM, Weese-Mayer DE. Congenital central hypoventilation syndrome: neurocognitive functioning in school age children. Pediatr Pulmonol. 2010;45:92-8. PMID:19960523.
70. Charnay AJ, Antisdel-Lomaglio JE, Zelko FA, Rand CM, Le M, Gordon SC, et al. Congenital central hypoventilation syndrome: neurocognition already reduced in preschool-aged children. Chest. 2016;149:809-15. PMID:26378991.
71. Todd ES, Weinberg SM, Berry-Kravis EM, Silvestri JM, Kenny AS, Rand CM, et al. Facial phenotype in children and young adults with PHOX2B-determined congenital central hypoventilation syndrome: quantitative pattern of dysmorphology. Pediatr Res. 2006;59:39-45. PMID:16327002.
72. Weese-Mayer DE, Rand CM, Zhou A, Carroll MS, Hunt CE. Congenital central hypoventilation syndrome: a bedside-to-bench success story for advancing early diagnosis and treatment and improved survival and quality of life. Pediatr Res. 2017;81(1-2):192-201. PMID:27673423.
73. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 152 (Costello syndrome).
74. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 1053 (Appendix, neoplasia).
75. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 219 (Beckwith–Wiedemann syndrome).
76. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 224 (Simpson–Golabi–Behmel syndrome).
77. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 752 (Noonan syndrome with multiple lentigines).
78. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 106 (Rubinstein–Taybi syndrome).
79. Jones KL, Jones MC, del Campo M. Smith's Recognizable Patterns of Human Malformation. 8th ed. Philadelphia: Elsevier; 2022. p. 452 (Fanconi pancytopenia syndrome).
80. Harvengt J, Gernay C, Mastouri M, Farhat N, Lebrethon MC, Seghaye MC, Bours V. ROHHAD(NET) syndrome: systematic review of the clinical timeline and recommendations for diagnosis and prognosis. J Clin Endocrinol Metab. 2020;105:dgaa247. PMID:32407531.
81. Diller L, Cherkerzian S, Cinelli AE, Housman D, Gillani R, Hamilton KV, et al. Population-based genomic detection of childhood cancer predisposition using newborn dried blood spots. Nat Commun. 2026;17(1):8183. doi:10.1038/s41467-026-76296-8.
82. U.S. Food and Drug Administration, Office of Orphan Products Development. Search Orphan Drug Designations and Approvals: searches for “neuroblastoma” (51 designations), “hypoventilation” and “Ondine” (no results), 01/01/1983 to 17/10/2026. [https://www.accessdata.fda.gov/scripts/opdlisting/oopd/index.cfm](https://www.accessdata.fda.gov/scripts/opdlisting/oopd/index.cfm). Accessed 17 Oct 2026.
83. Goldsmith KC, Park JR, Kayser K, Malvar J, Chi YY, Groshen SG, et al. Lorlatinib with or without chemotherapy in ALK-driven refractory/relapsed neuroblastoma: phase 1 trial results. Nat Med. 2023;29(5):1092-102. doi:10.1038/s41591-023-02297-5.
84. Nyhan WL, Hoffmann GF, Al-Aqeel AI, Barshop BA. Atlas of Inherited Metabolic Diseases. 4th ed. Boca Raton: CRC Press; 2020. p. 6 (Introduction to the organic acidemias).
85. Saudubray JM, Baumgartner MR, García-Cazorla Á, Walter J, editors. Inborn Metabolic Diseases: Diagnosis and Treatment. 7th ed. Berlin: Springer; 2022. Chapter 20, section 20.7 Cystathionine γ-Lyase Deficiency, 20.7.4 Diagnostic Tests.
86. Weese-Mayer DE, Berry-Kravis EM, Ceccherini I, Keens TG, Loghmanee DA, Trang H; ATS Congenital Central Hypoventilation Syndrome Subcommittee. An official ATS clinical policy statement: congenital central hypoventilation syndrome: genetic basis, diagnosis, and management. Am J Respir Crit Care Med. 2010;181(6):626-44. doi:10.1164/rccm.200807-1069ST.
87. Jennings LJ, Yu M, Zhou L, Rand CM, Berry-Kravis EM, Weese-Mayer DE. Comparison of PHOX2B testing methods in the diagnosis of congenital central hypoventilation syndrome and mosaic carriers. Diagn Mol Pathol. 2010;19:224-31. PMID:21051998.
88. Nyhan WL, Hoffmann GF, Al-Aqeel AI, Barshop BA. Atlas of Inherited Metabolic Diseases. 4th ed. Boca Raton: CRC Press; 2020. p. 362 (Introduction to lactic acidemias).
89. Nyhan WL, Hoffmann GF, Al-Aqeel AI, Barshop BA. Atlas of Inherited Metabolic Diseases. 4th ed. Boca Raton: CRC Press; 2020. p. 383 (Pyruvate dehydrogenase complex deficiency).
90. Saudubray JM, Baumgartner MR, García-Cazorla Á, Walter J, editors. Inborn Metabolic Diseases: Diagnosis and Treatment. 7th ed. Berlin: Springer; 2022. Chapter 39, section 39.2.1 Disorders of Pre-tRNA Splicing.
91. Firth HV, Hurst JA. Oxford Desk Reference: Clinical Genetics and Genomics. 2nd ed. Oxford: Oxford University Press; 2017. p. 521 (Rett syndrome).
92. Firth HV, Hurst JA. Oxford Desk Reference: Clinical Genetics and Genomics. 2nd ed. Oxford: Oxford University Press; 2017. p. 92 (Cerebellar anomalies).
93. Nyhan WL, Hoffmann GF, Al-Aqeel AI, Barshop BA. Atlas of Inherited Metabolic Diseases. 4th ed. Boca Raton: CRC Press; 2020. p. 715 (Lysosomal acid lipase deficiency).
94. Armstrong AE, Weese-Mayer DE, Mian A, Maris JM, Batra V, Gosiengfiao Y, et al. Treatment of neuroblastoma in congenital central hypoventilation syndrome with a PHOX2B polyalanine repeat expansion mutation: new twist on a neurocristopathy syndrome. Pediatr Blood Cancer. 2015;62(11):2007-10. doi:10.1002/pbc.25572.
95. Foster JH, Voss SD, Hall DC, Minard CG, Balis FM, Wilner K, et al. Activity of crizotinib in patients with ALK-aberrant relapsed/refractory neuroblastoma: a Children's Oncology Group study (ADVL0912). Clin Cancer Res. 2021;27(13):3543-8. doi:10.1158/1078-0432.CCR-20-4224.
96. Mossé YP, Lim MS, Voss SD, Wilner K, Ruffner K, Laliberte J, et al. Safety and activity of crizotinib for paediatric patients with refractory solid tumours or anaplastic large-cell lymphoma: a Children's Oncology Group phase 1 consortium study. Lancet Oncol. 2013;14(6):472-80. doi:10.1016/S1470-2045(13)70095-0.
97. Xie W, Zhang Y, Lu S, Sun F, Zhu J, Que Y, et al. Lorlatinib monotherapy or combination therapy in anaplastic lymphoma kinase-driven high-risk neuroblastoma. NPJ Precis Oncol. 2026;10(1):304. doi:10.1038/s41698-026-01487-x.
98. U.S. Food and Drug Administration. LORBRENA (lorlatinib) tablets, prescribing information. NDA 210868. Pfizer; label effective 2026-02-13 (openFDA). Drugs@FDA: original approval 2018-11-02. https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&ApplNo=210868
99. U.S. Food and Drug Administration. XALKORI (crizotinib) capsules/oral pellets, prescribing information. NDA 202570/217581. Pfizer; label effective 2025-07-22 (openFDA). https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&ApplNo=202570
100. Mori T, Kada A, Osumi T, Tomizawa D, Koga Y, Fukano R, et al. Phase 1/2 study of crizotinib in children with relapsed/refractory ALK-positive anaplastic large cell lymphoma or neuroblastoma in Japan. Cancer Sci. 2026;117(3):777-86. doi:10.1111/cas.70308.
101. Fischer M, Moreno L, Ziegler DS, Marshall LV, Zwaan CM, Irwin MS, et al. Ceritinib in paediatric patients with anaplastic lymphoma kinase-positive malignancies: an open-label, multicentre, phase 1, dose-escalation and dose-expansion study. Lancet Oncol. 2021;22(12):1764-76. doi:10.1016/S1470-2045(21)00536-2.
102. Novartis. ZYKADIA (ceritinib) tablets. Prescribing information; label version of 15 Dec 2025 [Internet]. openFDA. Accessed 26 Oct 2026.
103. European Medicines Agency. Zykadia (ceritinib) — EPAR. https://www.ema.europa.eu/en/medicines/human/EPAR/zykadia
104. European Medicines Agency. Lorviqua (lorlatinib) — EPAR. https://www.ema.europa.eu/en/medicines/human/EPAR/lorviqua
105. European Medicines Agency. Xalkori (crizotinib) — EPAR. https://www.ema.europa.eu/en/medicines/human/EPAR/xalkori
106. Wei W, Fader ME, Kushner BH, Cardenas FI, Kramer K, Basu E, et al. Pulmonary toxicity associated with concurrent lorlatinib and anti-GD2 monoclonal antibody therapy in patients with neuroblastoma. Pediatr Blood Cancer. 2025;72(9):e31845. doi:10.1002/pbc.31845.
107. U.S. Food and Drug Administration. IWILFIN (eflornithine) tablets, prescribing information. NDA 215500. US WorldMeds; label effective 2026-03-26 (openFDA). Drugs@FDA: approval 2023-12-13. https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&ApplNo=215500
108. European Medicines Agency. Ifinwil: withdrawal of the marketing authorisation application (eflornithine). EMA/238203/2025. 25 Jul 2025. https://www.ema.europa.eu/en/medicines/human/EPAR/ifinwil
109. European Medicines Agency. Qarziba (dinutuximab beta) — EPAR. https://www.ema.europa.eu/en/medicines/human/EPAR/qarziba
110. European Medicines Agency. Unituxin (dinutuximab) — EPAR (withdrawn). https://www.ema.europa.eu/en/medicines/human/EPAR/unituxin
111. United Therapeutics. UNITUXIN (dinutuximab) injection, for intravenous use. Prescribing information; label version of 6 Jul 2026 [Internet]. openFDA. Accessed 26 Oct 2026.
112. BTG International (current label holder). DANYELZA (naxitamab-gqgk) injection, for intravenous use. Prescribing information; label version of 7 Aug 2026 [Internet]. openFDA. Accessed 26 Oct 2026.
113. Nuvalent, Inc. Nuvalent announces key program and business updates, strengthening foundation for global leadership in ROS1- and ALK-positive NSCLC [press release]. 27 May 2026. [https://investors.nuvalent.com/2026-05-27-Nuvalent-Announces-Key-Program-and-Business-Updates,-Strengthening-Foundation-for-Global-Leadership-in-ROS1-and-ALK-positive-NSCLC](https://investors.nuvalent.com/2026-05-27-Nuvalent-Announces-Key-Program-and-Business-Updates,-Strengthening-Foundation-for-Global-Leadership-in-ROS1-and-ALK-positive-NSCLC); Nuvalent, Inc. Schedule 14D-9 (24 Jun 2026) and Form 8-K (9 Jun 2026); GSK plc. Form 6-K (15 Jul, 22 Jul and 8 Sep 2026). U.S. Securities and Exchange Commission, EDGAR. [https://www.sec.gov/cgi-bin/browse-edgar?action=getcompany&CIK=1861560](https://www.sec.gov/cgi-bin/browse-edgar?action=getcompany&CIK=1861560). Accessed 17 Oct 2026.
114. ClinicalTrials.gov. API v2 search “neuroblastoma” × ALK inhibitors (NCT03107988, NCT04753658, NCT02780128, NCT01742286, NCT05770037, NCT02559778, NCT00939770, NCT01606878, NCT01121588). https://clinicaltrials.gov
115. ClinicalTrials.gov. NCT03126916 — Testing the addition of 131I-MIBG or lorlatinib to intensive therapy in people with high-risk neuroblastoma (ANBL1531). https://clinicaltrials.gov/study/NCT03126916
116. Imazu T, Kubota H, Saida S, Nishio S, Tojo R, Uchihara Y, et al. Feasibility and efficacy of lorlatinib in Japanese patients with relapsed/refractory ALK-aberrant neuroblastoma. Pediatr Blood Cancer. 2026;73(9):e70511. doi:10.1002/1545-5017.70511. PMID:42499277.
117. Neuroblastoma UK. SIOPEN High-Risk Neuroblastoma Study 2: progress update. https://www.neuroblastoma.org.uk/news/high-risk-neuroblastoma-study-2-of-siopen
118. Valika T, Chin AC, Thompson DM, Kabre R, Lavin JM, Neault SH, et al. Airway obstruction during sleep due to diaphragm pacing precludes decannulation in young children with congenital central hypoventilation syndrome. Respiration. 2019;98:263-7. PMID:31288244.
119. Straus C, Trang H, Becquemin MH, Touraine P, Similowski T. Chemosensitivity recovery in Ondine's curse syndrome under treatment with desogestrel. Respir Physiol Neurobiol. 2010;171:171-4. PMID:20303419.
120. U.S. Food and Drug Administration. Midodrine hydrochloride tablets, prescribing information (generic); label effective 2023-01-27 (openFDA). https://api.fda.gov/drug/label.json?search=openfda.generic_name:midodrine
121. U.S. Food and Drug Administration. GENOTROPIN (somatropin) for injection, prescribing information. Pfizer; label effective 2026-08-04 (openFDA). https://api.fda.gov/drug/label.json?search=openfda.brand_name:genotropin
122. European Medicines Agency. Synagis (palivizumab) — EPAR, summary of product characteristics (first authorisation 13 Aug 1999). https://www.ema.europa.eu/en/medicines/human/EPAR/synagis
123. European Medicines Agency. Beyfortus (nirsevimab) — EPAR, summary of product characteristics (first authorisation 31 Oct 2022; extension to the 2nd season, II/0005, 1 Aug 2024) [accessed 2026-11-07]. https://www.ema.europa.eu/en/medicines/human/EPAR/beyfortus
124. U.S. Food and Drug Administration. Drugs@FDA: ENFLONSIA (clesrovimab) injection, BLA 761432; approval 2025 Jun 9 [accessed 7 Nov 2026]. Available from: https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/761432s000lbledt.pdf
125. European Medicines Agency. Enflonsia (clesrovimab): EPAR — product information. EMEA/H/C/006497; CHMP opinion 18/09/2025; authorisation 15/04/2026 [accessed 7 Nov 2026]. Available from: https://www.ema.europa.eu/en/medicines/human/EPAR/enflonsia
126. Orphanet. Congenital central hypoventilation syndrome (ORPHA:661). https://www.orpha.net/en/disease/detail/661
127. AISICC OdV — Associazione Italiana per la Sindrome da Ipoventilazione Centrale Congenita (Sindrome di Ondine). [https://www.sindromediondine.it](https://www.sindromediondine.it). Accessed 17 Oct 2026.
128. Selbsthilfegruppe Undine Syndrom e.V. [https://undine-syndrom.de/](https://undine-syndrom.de/). Accessed 17 Oct 2026.
129. European Reference Network for Paediatric Oncology (ERN PaedCan). [https://paedcan.ern-net.eu/](https://paedcan.ern-net.eu/). Accessed 17 Oct 2026.
130. European Reference Network on Genetic Tumour Risk Syndromes (ERN GENTURIS). [https://genturis.eu/](https://genturis.eu/). Accessed 17 Oct 2026.
131. European Reference Network for rare Inherited and Congenital (digestive and gastrointestinal) Anomalies (ERNICA). Intestinal diseases; For patients and families. [https://www.ern-ernica.eu/](https://www.ern-ernica.eu/). Accessed 17 Oct 2026.
132. Orphanet. Congenital central hypoventilation syndrome (ORPHA:661): patient organisations and networks of experts. [https://www.orpha.net/en/patient-organisations?orphaCode=661](https://www.orpha.net/en/patient-organisations?orphaCode=661). Directory updated on 1 Jul 2026; accessed 17 Oct 2026.
133. European Reference Network on Rare Respiratory Diseases (ERN-LUNG). [https://ern-lung.eu/](https://ern-lung.eu/). Accessed 17 Oct 2026.
134. European Reference Network on Rare Congenital Malformations and Rare Intellectual Disability (ERN-ITHACA). [https://www.ern-ithaca.eu/](https://www.ern-ithaca.eu/). Accessed 17 Oct 2026.
135. SIOP Europe Neuroblastoma (SIOPEN). [https://www.siopen.net/](https://www.siopen.net/). Accessed 17 Oct 2026.
136. Charity Commission for England and Wales. Keep Me Breathing, charity no. 1201757: charity overview. [https://register-of-charities.charitycommission.gov.uk/en/charity-search/-/charity-details/5207327/charity-overview](https://register-of-charities.charitycommission.gov.uk/en/charity-search/-/charity-details/5207327/charity-overview). Accessed 17 Oct 2026.
137. CCHS Network. [https://cchsnetwork.org/](https://cchsnetwork.org/). Accessed 17 Oct 2026.
138. Solving Kids' Cancer UK. [https://www.solvingkidscancer.org.uk/](https://www.solvingkidscancer.org.uk/). Accessed 17 Oct 2026.
139. Acreditar — Associação de Pais e Amigos de Crianças com Cancro. [https://www.acreditar.org.pt/](https://www.acreditar.org.pt/). Accessed 17 Oct 2026.